Login to display prices
Login to display prices
ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene View larger

ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene

PTXBC008981

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene

Proteogenix catalog: PTXBC008981
Ncbi symbol: ATP6V1E2
Product name: ATP6V1E2-ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2 Gene
Size: 2ug
Accessions: BC008981
Gene id: 90423
Gene description: ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
Synonyms: ATP6E1; ATP6EL2; ATP6V1EL2; VMA4; V-type proton ATPase subunit E 2; ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2; V-ATPase subunit E 2; testis secretory sperm-binding protein Li 235P; vacuolar proton pump subunit E 2; vacuolar-type proton-translocating ATPase subunit E1; ATPase H+ transporting V1 subunit E2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgagtgatgtcgatgtgaaaaagcagattaagcacatgatggctttcattgagcaggaagccaatgagaaagcagaggaaatcgatgccaaggctgaggaagagtttaacattgagaaaggacgcctcgtgcaaacccaacgactgaagattatggagtattatgagaaaaaggagaagcagatagagcagcagaagaaaatcctgatgtccaccatgaggaatcaggcgaggctgaaagtcctgagagcccgaaatgacctcatctcagatttgctcagtgaggcgaagctgagactcagcaggattgtggaggacccagaggtctaccaggggctgctggataaactggtgctccagggtctgctccgactgctggaacctgtgatgattgtacgctgccggccacaagacctcctcctggtggaggctgctgtacaaaaagccatccccgagtacatgacaatttcccagaaacatgtggaggtccagattgataaagaggcatacctggctgtgaatgcagctggaggtgtggaggtctacagtggcaatcagagaataaaggtttcaaataccttggaaagccgactggatctctcagccaagcaaaagatgccagaaatacgaatggccttgtttggtgctaacaccaacagaaagttctttatataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: