PPP1R1B-protein phosphatase 1, regulatory (inhibitor) subunit 1B Gene View larger

PPP1R1B-protein phosphatase 1, regulatory (inhibitor) subunit 1B Gene

PTXBC001519

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPP1R1B-protein phosphatase 1, regulatory (inhibitor) subunit 1B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPP1R1B-protein phosphatase 1, regulatory (inhibitor) subunit 1B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001519
Product type: DNA & cDNA
Ncbi symbol: PPP1R1B
Origin species: Human
Product name: PPP1R1B-protein phosphatase 1, regulatory (inhibitor) subunit 1B Gene
Size: 2ug
Accessions: BC001519
Gene id: 84152
Gene description: protein phosphatase 1, regulatory (inhibitor) subunit 1B
Synonyms: DARPP-32; DARPP32; protein phosphatase 1 regulatory subunit 1B; dopamine and cAMP-regulated neuronal phosphoprotein 32; protein phosphatase 1 regulatory inhibitor subunit 1B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgttccggctctcagagcactcctcaccagaggaggaagcctccccccaccagagagcctcaggagaggggcaccatctcaagtcgaagagacccaacccctgtgcctacacaccaccttcgctgaaagctgtgcagcgcattgctgagtctcacctgcagtctatcagcaatttgaatgagaaccaggcctcagaggaggaggatgagctgggggagcttcgggagctgggttatccaagagaggaagatgaggaggaagaggaggatgatgaagaagaggaagaagaagaggacagccaggctgaagtcctgaaggtcatcaggcagtctgctgggcaaaagacaacctgtggccagggtctggaagggccctgggagcgcccaccccctctggatgagtccgagagagatggaggctctgaggaccaagtggaagacccagcactaagtgagcctggggaggaacctcagcgcccttccccctctgagcctggcacatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 26 (sulfate transporter), member 1
- ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E2
- DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)
- ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1

Buy PPP1R1B-protein phosphatase 1, regulatory (inhibitor) subunit 1B Gene now

Add to cart