Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene
PTXBC020494
New product
Data sheet of BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020494 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BLOC1S2 |
| Origin species: | Human |
| Product name: | BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene |
| Size: | 2ug |
| Accessions: | BC020494 |
| Gene id: | 282991 |
| Gene description: | biogenesis of lysosomal organelles complex-1, subunit 2 |
| Synonyms: | BLOS2; BORCS2; CEAP; CEAP11; biogenesis of lysosome-related organelles complex 1 subunit 2; 11 kDa centrosome associated protein; BLOC-1 subunit 2; centrosomal 10 kDa protein; centrosome protein oncogene; biogenesis of lysosomal organelles complex 1 subunit 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttctccaaaatggccacttacctgactggggaactgacggccaccagtgaagactataagctcctggaaaatatgaataaactcaccagcttgaagtatcttgaaatgaaagatattgctataaacattagtaggaacttaaaggacttaaaccagaaatatgctggactgcagccttatctggatcagatcaatgtcattgaagagcaggtagcagctcttgagcaggcagcttacaagttggatgcatattcaaaaaaactggaagccaagtacaagaagctggagaagcgatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal modification protein rimK-like family member B - oligodendrocytic myelin paranodal and inner loop protein - cysteine and glycine-rich protein 3 (cardiac LIM protein) - nucleolar protein 3 (apoptosis repressor with CARD domain) |