BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene View larger

BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020494
Product type: DNA & cDNA
Ncbi symbol: BLOC1S2
Origin species: Human
Product name: BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene
Size: 2ug
Accessions: BC020494
Gene id: 282991
Gene description: biogenesis of lysosomal organelles complex-1, subunit 2
Synonyms: BLOS2; BORCS2; CEAP; CEAP11; biogenesis of lysosome-related organelles complex 1 subunit 2; 11 kDa centrosome associated protein; BLOC-1 subunit 2; centrosomal 10 kDa protein; centrosome protein oncogene; biogenesis of lysosomal organelles complex 1 subunit 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttctccaaaatggccacttacctgactggggaactgacggccaccagtgaagactataagctcctggaaaatatgaataaactcaccagcttgaagtatcttgaaatgaaagatattgctataaacattagtaggaacttaaaggacttaaaccagaaatatgctggactgcagccttatctggatcagatcaatgtcattgaagagcaggtagcagctcttgagcaggcagcttacaagttggatgcatattcaaaaaaactggaagccaagtacaagaagctggagaagcgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal modification protein rimK-like family member B
- oligodendrocytic myelin paranodal and inner loop protein
- cysteine and glycine-rich protein 3 (cardiac LIM protein)
- nucleolar protein 3 (apoptosis repressor with CARD domain)

Buy BLOC1S2-biogenesis of lysosomal organelles complex-1, subunit 2 Gene now

Add to cart