Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RIMKLB-ribosomal modification protein rimK-like family member B Gene
PTXBC033793
New product
Data sheet of RIMKLB-ribosomal modification protein rimK-like family member B Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RIMKLB-ribosomal modification protein rimK-like family member B Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033793 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RIMKLB |
| Origin species: | Human |
| Product name: | RIMKLB-ribosomal modification protein rimK-like family member B Gene |
| Size: | 2ug |
| Accessions: | BC033793 |
| Gene id: | 57494 |
| Gene description: | ribosomal modification protein rimK-like family member B |
| Synonyms: | FAM80B; NAAGS; NAAGS-I; beta-citrylglutamate synthase B; N-acetyl-aspartyl-glutamate synthetase B; N-acetyl-aspartylglutamate synthetase B; N-acetylaspartyl-glutamate synthetase B; NAAG synthetase B; beta-citryl-glutamate synthase B; family with sequence similarity 80, member B; ribosomal protein S6 modification-like protein B; ribosomal modification protein rimK like family member B |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgtagttctgtggctgccaagttgtggtttttgacagatcgtcgcatcagggaagactatcctcaaaaagagattttacgagcattgaaggccaaatgttgtgaggaggaactggactttagggctgtggtgatggatgaggtggtgctgacaatcgagcaaggaaacctgggtctgcggatcaatggagagctaatcactgcctacccacaagtggtggtagtcagagtaccaaccccttgggtgcaaagtgatagtgacatcactgttttgcgccatctagagaagatgggatgtcggttaatgaaccgacctcaagccatcctgaactgcgttaataagttctggacatttcaagagttggctggccatggtgttcctctgccggatactttctcttatggtggccacgaaaattttgctaaaatgattgatgaggctgaagttctggagttcccaatggtagtaaagaatacgcggggtcacagaggtaaagctgttttcttggctcgagataagcaccatttggctgatctaagccatcttattcgccatgaagcgccatacctgttccagaagtatgttaaagagtctcatggacgggatgtacgtgtcattgtcgtgggaggccgtgtggttggcaccatgttacgttgttcaacagatgggagaatgcaaagcaactgctcattaggtggtgtggggatgatgtgctcattgagtgaacaagggaagcagctagctatccaggtgtctaatatcctggggatggatgtgtgtggcattgacctgctgatgaaagatgacggctccttctgcgtctgtgaggccaatgcaaatccttttcaggagccaaaaaaacaaatacaaacaaacaaaaaaatacccagagaaaaaactttccttcttcccccttcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - oligodendrocytic myelin paranodal and inner loop protein - cysteine and glycine-rich protein 3 (cardiac LIM protein) - nucleolar protein 3 (apoptosis repressor with CARD domain) - transmembrane emp24 protein transport domain containing 3 |