OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene View larger

OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC033737
Product type: DNA & cDNA
Ncbi symbol: OPALIN
Origin species: Human
Product name: OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene
Size: 2ug
Accessions: BC033737
Gene id: 93377
Gene description: oligodendrocytic myelin paranodal and inner loop protein
Synonyms: HTMP10; TMEM10; TMP10; transmembrane protein 10; transmembrane protein TMP10; oligodendrocytic myelin paranodal and inner loop protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtttttcactgaacttcaccctgccggcgaacacaacgtcctctcctgtcacaggtgggaaagaaacggactgtgggccctctcttggattagcggcgggcataccattgctggtggccacagccctgctggtggctttactatttactttgattcaccgaagaagaagcagcattgaggccatggaggaaagtgacagaccatgtgaaatttcagaaattgatgacaatcccaagatatctgagaatcctaggagatcacccacacatgagaagaatacgatgggagcacaagaggcccacatatatgtgaagactgtagcaggaagcgaggaacctgtgcatgaccgttaccgtcctactatagaaatggaaagaaggaggggattgtggtggcttgtgcccagactgagcctggaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteine and glycine-rich protein 3 (cardiac LIM protein)
- nucleolar protein 3 (apoptosis repressor with CARD domain)
- transmembrane emp24 protein transport domain containing 3
- transmembrane emp24 protein transport domain containing 7

Buy OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene now

Add to cart