Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene
PTXBC033737
New product
Data sheet of OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033737 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | OPALIN |
| Origin species: | Human |
| Product name: | OPALIN-oligodendrocytic myelin paranodal and inner loop protein Gene |
| Size: | 2ug |
| Accessions: | BC033737 |
| Gene id: | 93377 |
| Gene description: | oligodendrocytic myelin paranodal and inner loop protein |
| Synonyms: | HTMP10; TMEM10; TMP10; transmembrane protein 10; transmembrane protein TMP10; oligodendrocytic myelin paranodal and inner loop protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtttttcactgaacttcaccctgccggcgaacacaacgtcctctcctgtcacaggtgggaaagaaacggactgtgggccctctcttggattagcggcgggcataccattgctggtggccacagccctgctggtggctttactatttactttgattcaccgaagaagaagcagcattgaggccatggaggaaagtgacagaccatgtgaaatttcagaaattgatgacaatcccaagatatctgagaatcctaggagatcacccacacatgagaagaatacgatgggagcacaagaggcccacatatatgtgaagactgtagcaggaagcgaggaacctgtgcatgaccgttaccgtcctactatagaaatggaaagaaggaggggattgtggtggcttgtgcccagactgagcctggaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine and glycine-rich protein 3 (cardiac LIM protein) - nucleolar protein 3 (apoptosis repressor with CARD domain) - transmembrane emp24 protein transport domain containing 3 - transmembrane emp24 protein transport domain containing 7 |