TMED7-transmembrane emp24 protein transport domain containing 7 Gene View larger

TMED7-transmembrane emp24 protein transport domain containing 7 Gene

PTXBC019349

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMED7-transmembrane emp24 protein transport domain containing 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMED7-transmembrane emp24 protein transport domain containing 7 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019349
Product type: DNA & cDNA
Ncbi symbol: TMED7
Origin species: Human
Product name: TMED7-transmembrane emp24 protein transport domain containing 7 Gene
Size: 2ug
Accessions: BC019349
Gene id: 51014
Gene description: transmembrane emp24 protein transport domain containing 7
Synonyms: CGI-109; p24g3; p24gamma3; p27; transmembrane emp24 domain-containing protein 7; p24 family protein gamma-3; transmembrane emp24 protein transport domain containing 7; transmembrane p24 trafficking protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcggccggggtccgcgcagcgctgggcggccgtcgcgggccgttgggggtgcaggctgctcgcactgctgctactggtgcctggacccggcggcgcctctgagatcaccttcgagcttcctgacaacgccaagcagtgcttctacgaggacatcgctcagggcaccaagtgcaccctggagttccaggtgattactggtggtcactatgatgtagattgtcgattagaagatcctgatggtaaagtgttatacaaagagatgaagaaacagtatgatagttttaccttcacagcctccaaaaatgggacatacaaattttgcttcagcaatgaattttctactttcacacataaaactgtatattttgattttcaagttggagaagacccacctttgtttcctagtgagaaccgagtcagtgctcttacccagatggaatctgcctgtgtttcaattcacgaagctctgaagtctgtcatcgattatcagactcatttccgtttaagagaagctcaaggccgaagccgagcagaggatctaaatacaagagtggcctattggtcagtaggagaagccctcattcttctggtggttagcatagggcaggtatttcttttgaaaagctttttctcagataaaagaaccaccacaactcgtgttggatcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MKI67 (FHA domain) interacting nucleolar phosphoprotein
- oligonucleotide/oligosaccharide-binding fold containing 1
- solute carrier family 46 (folate transporter), member 1
- polymerase (RNA) III (DNA directed) polypeptide C (62kD)

Buy TMED7-transmembrane emp24 protein transport domain containing 7 Gene now

Add to cart