Login to display prices
Login to display prices
TMED7-transmembrane emp24 protein transport domain containing 7 Gene View larger

TMED7-transmembrane emp24 protein transport domain containing 7 Gene

PTXBC019349

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMED7-transmembrane emp24 protein transport domain containing 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMED7-transmembrane emp24 protein transport domain containing 7 Gene

Proteogenix catalog: PTXBC019349
Ncbi symbol: TMED7
Product name: TMED7-transmembrane emp24 protein transport domain containing 7 Gene
Size: 2ug
Accessions: BC019349
Gene id: 51014
Gene description: transmembrane emp24 protein transport domain containing 7
Synonyms: CGI-109; p24g3; p24gamma3; p27; transmembrane emp24 domain-containing protein 7; p24 family protein gamma-3; transmembrane emp24 protein transport domain containing 7; transmembrane p24 trafficking protein 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcggccggggtccgcgcagcgctgggcggccgtcgcgggccgttgggggtgcaggctgctcgcactgctgctactggtgcctggacccggcggcgcctctgagatcaccttcgagcttcctgacaacgccaagcagtgcttctacgaggacatcgctcagggcaccaagtgcaccctggagttccaggtgattactggtggtcactatgatgtagattgtcgattagaagatcctgatggtaaagtgttatacaaagagatgaagaaacagtatgatagttttaccttcacagcctccaaaaatgggacatacaaattttgcttcagcaatgaattttctactttcacacataaaactgtatattttgattttcaagttggagaagacccacctttgtttcctagtgagaaccgagtcagtgctcttacccagatggaatctgcctgtgtttcaattcacgaagctctgaagtctgtcatcgattatcagactcatttccgtttaagagaagctcaaggccgaagccgagcagaggatctaaatacaagagtggcctattggtcagtaggagaagccctcattcttctggtggttagcatagggcaggtatttcttttgaaaagctttttctcagataaaagaaccaccacaactcgtgttggatcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: