Login to display prices
Login to display prices
POLR3C-polymerase (RNA) III (DNA directed) polypeptide C (62kD) Gene View larger

POLR3C-polymerase (RNA) III (DNA directed) polypeptide C (62kD) Gene


New product

Data sheet of POLR3C-polymerase (RNA) III (DNA directed) polypeptide C (62kD) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about POLR3C-polymerase (RNA) III (DNA directed) polypeptide C (62kD) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002586
Product type: DNA & cDNA
Ncbi symbol: POLR3C
Origin species: Human
Product name: POLR3C-polymerase (RNA) III (DNA directed) polypeptide C (62kD) Gene
Size: 2ug
Accessions: BC002586
Gene id: 10623
Gene description: polymerase (RNA) III (DNA directed) polypeptide C (62kD)
Synonyms: RPC3; RPC62; DNA-directed RNA polymerase III subunit RPC3; DNA-directed III 62 kDa polypeptide; DNA-directed RNA polymerase III subunit C; RNA polymerase III 62 kDa subunit; RNA polymerase III subunit C3; polymerase (RNA) III (DNA directed) polypeptide C (62kD); polymerase (RNA) III subunit C; RNA polymerase III subunit C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgactcaagcagaaattaagctctgttctttgttgctgcaagagcattttggagagattgtagaaaaaattggagtccatctgataagaaccggcagccagccactaagagtaattgcccatgacacaggaacatcactggatcaggtgaagaaagccctgtgtgtcctcgtccaacataacctggtgagttatcaagtgcacaaacgtggtgtggtggagtatgaagcccagtgcagccgggtattgcgaatgcttagatatccccggtacatctatactaccaaaactctgtacagtgacactggagagctgattgttgaggagcttctgttgaacggcaaactgacaatgtcagctgttgtgaagaaagtggcagaccggctcacagagaccatggaggatggcaagaccatggactatgctgaagtatcaaacacatttgtgcgactggcagacacacactttgtacaacgctgcccttcggtacctaccactgagaattcagaccctgggccaccaccacctgcccccacacttgtcattaatgaaaaggacatgtacctggttcctaaactcagcttgatagggaaaggtaaaaggaggagatcatctgatgaagatgctgctggggagcccaaggccaagagaccaaaatatactacagataacaaggagcccattccagatgatgggatttattggcaggccaaccttgacagattccaccaacacttccgtgaccaagccattgtgagcgcagttgctaacaggatggaccagacaagcagcgagattgtgcgaaccatgctccgaatgagtgagattaccacttcctctagtgctcccttcacccagccattgtcttccaatgagatcttcagatccctacctgttggctataacatctctaagcaagttcttgatcagtatctcactctgctggcagatgatccactagagtttgttggaaagtctggcgacagtggtggaggaatgtatgtcatcaacctccataaggcattagcatccctagccacagccactctggagtccgtcgtacaggagagatttgggtctcgctgtgctagaatattccgtctagttttgcagaagaaacacatagagcagaagcaagtggaagactttgcaatgattcctgcaaaggaggcaaaggatatgctatataagatgctctcagaaaatttcatgtcactccaggaaattcccaaaacaccagaccatgccccatccaggaccttctatttatatactgtgaacatcctgtcagctgcccgaatgttgttgcacaggtgctacaagagcatagccaacttgatagaaaggaggcaatttgaaaccaaagagaataagcgtctactagaaaaatctcagagggtagaagccatcattgcatctatgcaggctactggtgcagaggaagcacagttacaagaaatagaggagatgatcacagctcctgaacgtcagcagctagagaccctgaaacgtaatgtcaacaagttggatgccagtgagatccaggtggacgaaaccatcttcctgctggagtcttacattgagtgcaccatgaagagacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor associated sorting protein 2
- polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
- ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
- receptor (G protein-coupled) activity modifying protein 1