Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene
PTXBC005903
New product
Data sheet of POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005903 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2L |
| Origin species: | Human |
| Product name: | POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene |
| Size: | 2ug |
| Accessions: | BC005903 |
| Gene id: | 5441 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa |
| Synonyms: | RBP10; RPABC5; RPB10; RPB10beta; RPB7.6; hRPB7.6; DNA-directed RNA polymerases I, II, and III subunit RPABC5; DNA-directed RNA polymerase III subunit L; RNA polymerase II 7.6 kDa subunit; RNA polymerases I, II, and III subunit ABC5; RPB10 homolog; polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa; polymerase (RNA) II subunit L; RNA polymerase II subunit L |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcatccctgtacgctgcttcacttgtggcaagatcgtcggcaacaagtgggaggcttacctggggctgctgcaggccgagtacaccgagggggatgcgctggatgccctgggcctgaagcgctactgctgccgccggatgctgctggcccacgtggacctgatcgagaagctgctcaattatgcacccctggagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 - receptor (G protein-coupled) activity modifying protein 1 - ubiquitin-conjugating enzyme E2G 2 (UBC7 homolog, yeast) - myosin, light chain 3, alkali; ventricular, skeletal, slow |