Login to display prices
Login to display prices
MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene View larger

MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene

PTXBC022990

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene

Proteogenix catalog: PTXBC022990
Ncbi symbol: MKI67IP
Product name: MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene
Size: 2ug
Accessions: BC022990
Gene id: 84365
Gene description: MKI67 (FHA domain) interacting nucleolar phosphoprotein
Synonyms: MKI67IP; Nopp34; MKI67 FHA domain-interacting nucleolar phosphoprotein; hNIFK; nucleolar phosphoprotein Nopp34; nucleolar protein interacting with the FHA domain of pKi-67; nucleolar protein interacting with the FHA domain of MKI67
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgactttttctggcccggctgggccaatcctgtcgcttaatccgcaggaagatgtcgagtttcaaaaggaggtggcgcaggttcgcaagcgcataacccagcgaaaaaaacaagaacaacttactcctggagtagtctatgtgcgccacctacctaacctacttgacgaaacccagatcttttcatatttctcccagtttggcactgtgacacggttcaggctgtccagaagtaaaaggactggaaatagcaaaggctatgcatttgtggagtttgagtctgaggatgttgccaaaatagttgctgaaacaatgaacaactacctgtttggtgaaagactcttggagtgtcattttatgccacctgaaaaagtacataaagaactctttaaagactggaatattccatttaagcagccatcatatccatcagtgaaacggtataatcggaatcggacactaacacaaaagctacggatggaggagcgatttaaaaagaaagaaagattactcaggaagaaattagctaaaaaaggaattgactatgattttccttctttgattttacagaaaacggaaagtatttcaaaaactaatcgtcagacgtctacaaaaggccaggttttacgtaagaagaagaaaaaagtttcaggtactcttgacactcctgagaagactgtggatagccagggccccacaccagtttgtacaccaacatttttggagaggcgaaaatctcaagtggctgaactgaatgatgatgataaagatgatgaaatagttttcaaacagcccatatcctgtgtaaaagaagaaatacaagagactcaaacacctacacattcacggaaaaaaagacgaagaagcagcaatcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: