Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene
PTXBC022990
New product
Data sheet of MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022990 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MKI67IP |
| Origin species: | Human |
| Product name: | MKI67IP-MKI67 (FHA domain) interacting nucleolar phosphoprotein Gene |
| Size: | 2ug |
| Accessions: | BC022990 |
| Gene id: | 84365 |
| Gene description: | MKI67 (FHA domain) interacting nucleolar phosphoprotein |
| Synonyms: | MKI67IP; Nopp34; MKI67 FHA domain-interacting nucleolar phosphoprotein; hNIFK; nucleolar phosphoprotein Nopp34; nucleolar protein interacting with the FHA domain of pKi-67; nucleolar protein interacting with the FHA domain of MKI67 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgactttttctggcccggctgggccaatcctgtcgcttaatccgcaggaagatgtcgagtttcaaaaggaggtggcgcaggttcgcaagcgcataacccagcgaaaaaaacaagaacaacttactcctggagtagtctatgtgcgccacctacctaacctacttgacgaaacccagatcttttcatatttctcccagtttggcactgtgacacggttcaggctgtccagaagtaaaaggactggaaatagcaaaggctatgcatttgtggagtttgagtctgaggatgttgccaaaatagttgctgaaacaatgaacaactacctgtttggtgaaagactcttggagtgtcattttatgccacctgaaaaagtacataaagaactctttaaagactggaatattccatttaagcagccatcatatccatcagtgaaacggtataatcggaatcggacactaacacaaaagctacggatggaggagcgatttaaaaagaaagaaagattactcaggaagaaattagctaaaaaaggaattgactatgattttccttctttgattttacagaaaacggaaagtatttcaaaaactaatcgtcagacgtctacaaaaggccaggttttacgtaagaagaagaaaaaagtttcaggtactcttgacactcctgagaagactgtggatagccagggccccacaccagtttgtacaccaacatttttggagaggcgaaaatctcaagtggctgaactgaatgatgatgataaagatgatgaaatagttttcaaacagcccatatcctgtgtaaaagaagaaatacaagagactcaaacacctacacattcacggaaaaaaagacgaagaagcagcaatcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - oligonucleotide/oligosaccharide-binding fold containing 1 - solute carrier family 46 (folate transporter), member 1 - polymerase (RNA) III (DNA directed) polypeptide C (62kD) - G protein-coupled receptor associated sorting protein 2 |