Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PRG2-proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) Gene
PTXBC005929
New product
Data sheet of PRG2-proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PRG2-proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005929 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PRG2 |
| Origin species: | Human |
| Product name: | PRG2-proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) Gene |
| Size: | 2ug |
| Accessions: | BC005929 |
| Gene id: | 5553 |
| Gene description: | proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein) |
| Synonyms: | BMPG; MBP; MBP1; proMBP; bone marrow proteoglycan; eosinophil granule major basic protein; eosinophil major basic protein; natural killer cell activator; proteoglycan 2 preproprotein; proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein); proteoglycan 2, pro eosinophil major basic protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaactccccctacttctggctcttctatttggggcagtttctgctcttcatctaaggtctgagacttccacctttgagacccctttgggtgctaagacgctgcctgaggatgaggagacaccagagcaggagatggaggagaccccttgcagggagctggaggaagaggaggagtggggctctggaagtgaagatgcctccaagaaagatggggctgttgagtctatctcagtgccagatatggtggacaaaaaccttacgtgtcctgaggaagaggacacagtaaaagtggtgggcatccctgggtgccagacctgccgctacctcctggtgagaagtcttcagacgtttagtcaagcttggtttacttgccggaggtgctacaggggcaacctggtttccatccacaacttcaatattaattatcgaatccagtgttctgtcagcgcgctcaaccagggtcaagtctggattggaggcaggatcacaggctcgggtcgctgcagacgctttcagtgggttgacggcagccgctggaactttgcgtactgggctgctcaccagccctggtcccgcggtggtcactgcgtggccctgtgtacccgaggaggctactggcgtcgagcccactgcctcagaagacttcctttcatctgttcctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 12 (GalNAc-T12) - UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14) - myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 - serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 |