CXCL11-chemokine (C-X-C motif) ligand 11 Gene View larger

CXCL11-chemokine (C-X-C motif) ligand 11 Gene

PTXBC012532

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CXCL11-chemokine (C-X-C motif) ligand 11 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CXCL11-chemokine (C-X-C motif) ligand 11 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012532
Product type: DNA & cDNA
Ncbi symbol: CXCL11
Origin species: Human
Product name: CXCL11-chemokine (C-X-C motif) ligand 11 Gene
Size: 2ug
Accessions: BC012532
Gene id: 6373
Gene description: chemokine (C-X-C motif) ligand 11
Synonyms: H174; I-TAC; IP-9; IP9; SCYB11; SCYB9B; b-R1; C-X-C motif chemokine 11; beta-R1; chemokine (C-X-C motif) ligand 11; interferon gamma-inducible protein 9; interferon-inducible T-cell alpha chemoattractant; small inducible cytokine B11; small inducible cytokine subfamily B (Cys-X-Cys), member 11; small inducible cytokine subfamily B (Cys-X-Cys), member 9B; C-X-C motif chemokine ligand 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagtgtgaagggcatggctatagccttggctgtgatattgtgtgctacagttgttcaaggcttccccatgttcaaaagaggacgctgtctttgcataggccctggggtaaaagcagtgaaagtggcagatattgagaaagcctccataatgtacccaagtaacaactgtgacaaaatagaagtgattattaccctgaaagaaaataaaggacaacgatgcctaaaccccaaatcgaagcaagcaaggcttataatcaaaaaagttgaaagaaagaatttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S100 calcium binding protein A14
- thioredoxin domain containing 17
- hypothetical protein LOC339047
- similar to CG4995 gene product

Buy CXCL11-chemokine (C-X-C motif) ligand 11 Gene now

Add to cart