Login to display prices
Login to display prices
LOC339047-hypothetical protein LOC339047 Gene View larger

LOC339047-hypothetical protein LOC339047 Gene

PTXBC008178

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC339047-hypothetical protein LOC339047 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC339047-hypothetical protein LOC339047 Gene

Proteogenix catalog: PTXBC008178
Ncbi symbol: LOC339047
Product name: LOC339047-hypothetical protein LOC339047 Gene
Size: 2ug
Accessions: BC008178
Gene id: 339047
Gene description: hypothetical protein LOC339047
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcagtggagcatcgtcattcttcaggattgccctactggccctacctcacagctgaaactttaaaaaacaggatgggccaccagccacctcctccaactcaacaacattctataattgataactccctgagcctcaagacaccttccgagtgtgtgctctatccccttccaccctcagcggatgataatctcaagacacctcccgagtgtctgctcactccccttccaccctcagctctaccctcagcggatgataatctcaagacacctgccgagtgcctgctctatccccttccaccctcagcggatgataatctcaagacacctcccgagtgtctgctcactccccttccaccctcagctccaccctcagcggatgataatctcaagacacctcctgagtgtgtctgctcactccccttccaccctcagcggatgataatctcaagaaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice