Login to display prices
Login to display prices
CIRBP-cold inducible RNA binding protein Gene View larger

CIRBP-cold inducible RNA binding protein Gene

PTXBC000403

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CIRBP-cold inducible RNA binding protein Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CIRBP-cold inducible RNA binding protein Gene

Proteogenix catalog: PTXBC000403
Ncbi symbol: CIRBP
Product name: CIRBP-cold inducible RNA binding protein Gene
Size: 2ug
Accessions: BC000403
Gene id: 1153
Gene description: cold inducible RNA binding protein
Synonyms: CIRP; cold-inducible RNA-binding protein; A18 hnRNP; glycine-rich RNA binding protein; testicular tissue protein Li 39
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcatcagatgaaggcaaactttttgttggagggctgagttttgacaccaatgagcagtcgctggagcaggtcttctcaaagtacggacagatctctgaagtggtggttgtgaaagacagggagacccagagatctcggggatttgggtttgtcacctttgagaacattgacgacgctaaggatgccatgatggccatgaatgggaagtctgtagatggacggcagatccgagtagaccaggcaggcaagtcgtcagacaaccgatcccgtgggtaccgtggtggctctgccgggggccggggcttcttccgtgggggccgaggacggggccgtgggttctctagaggaggaggggaccgaggctatggggggaaccggttcgagtccaggagtgggggctacggaggctccagagactactatagcagccggagtcagagtggtggctacagtgaccggagctcgggcgggtcctacagagacagttatgacagttacgctacacacaacgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice