BID-BH3 interacting domain death agonist Gene View larger

BID-BH3 interacting domain death agonist Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BID-BH3 interacting domain death agonist Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BID-BH3 interacting domain death agonist Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009197
Product type: DNA & cDNA
Ncbi symbol: BID
Origin species: Human
Product name: BID-BH3 interacting domain death agonist Gene
Size: 2ug
Accessions: BC009197
Gene id: 637
Gene description: BH3 interacting domain death agonist
Synonyms: p22 BID; Human BID coding sequence; BID isoform Si6; BID isoform L(2); BID isoform ES(1b); FP497; BH3-interacting domain death agonist; apoptic death agonist; desmocollin type 4; BH3 interacting domain death agonist
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggactgtgaggtcaacaacggttccagcctcagggatgagtgcatcacaaacctactggtgtttggcttcctccaaagctgttctgacaacagcttccgcagagagctggacgcactgggccacgagctgccagtgctggctccccagtgggagggctacgatgagctgcagactgatggcaaccgcagcagccactcccgcttgggaagaatagaggcagattctgaaagtcaagaagacatcatccggaatattgccaggcacctcgcccaggtcggggacagcatggaccgtagcatccctccgggcctggtgaacggcctggccctgcagctcaggaacaccagccggtcggaggaggaccggaacagggacctggccactgccctggagcagctgctgcaggcctaccctagagacatggagaaggagaagaccatgctggtgctggccctgctgctggccaagaaggtggccagtcacacgccgtccttgctccgtgatgtctttcacacaacagtgaattttattaaccagaacctacgcacctacgtgaggagcttagccagaaatgggatggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - thioredoxin domain containing 10
- arginine/serine-rich coiled-coil 2
- chromosome 9 open reading frame 9
- N-acetylneuraminic acid phosphatase

Buy BID-BH3 interacting domain death agonist Gene now

Add to cart