Login to display prices
Login to display prices
TXNDC10-thioredoxin domain containing 10 Gene View larger

TXNDC10-thioredoxin domain containing 10 Gene

PTXBC032325

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TXNDC10-thioredoxin domain containing 10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TXNDC10-thioredoxin domain containing 10 Gene

Proteogenix catalog: PTXBC032325
Ncbi symbol: TXNDC10
Product name: TXNDC10-thioredoxin domain containing 10 Gene
Size: 2ug
Accessions: BC032325
Gene id: 54495
Gene description: thioredoxin domain containing 10
Synonyms: TXNDC10; PDIA13; protein disulfide-isomerase TMX3; protein disulfide isomerase family A, member 13; thioredoxin domain containing 10; thioredoxin domain-containing protein 10; thioredoxin related transmembrane protein 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagcgtggaagagttggacggccctgcggctctgcgccacagttgttgtacttgatatggtcgtctgtaaaggatttgtagaagatttagatgaatcgtttaaagaaaatcgaaatgatgacatttggcttgtagatttttatgcgccatggtgtggccattgtaaaaagctggaatcaatttggaatgaagttggtcttgagatgaaaagcattggttctccagttaaggttggaaagatggatgctacttcctattctagcattgcttcagagtttggagttcgaggttatccaacaattaagctattaaaaggggacttggcatataattatagaggaccacgaacaaaagatgatattattgagtttgctcacagagtatctggggctctaattcggccacttccaagtcaacaaatgtttgaacatatgcagaagagacaccgtgtatttttcgtttatgtaggtggagaatcacctttgaaagagaaatacatagatgctgcttcagaattgattgtatatacatacttcttttctgcctcagaagaagtggttcctgaggtaatatttaaaatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice