Login to display prices
Login to display prices
C9orf9-chromosome 9 open reading frame 9 Gene View larger

C9orf9-chromosome 9 open reading frame 9 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf9-chromosome 9 open reading frame 9 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf9-chromosome 9 open reading frame 9 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012940
Product type: DNA & cDNA
Ncbi symbol: C9orf9
Origin species: Human
Product name: C9orf9-chromosome 9 open reading frame 9 Gene
Size: 2ug
Accessions: BC012940
Gene id: 11092
Gene description: chromosome 9 open reading frame 9
Synonyms: C9orf9; Mast; sperm acrosome-associated protein 9; Rsb66 homolog; sperm acrosome associated 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatgaggtgaaagaatcccttcgcagcatcgagcagaagtacaagctcttccagcagcagcagctcaccttcaccgccgctctggagcactgcagggagaacgcccacgacaagatccggcccatctccagcattggacaggtgcagagctacatggaacactactgcaacagctccacagaccggcgggttctgctcatgttcctggacatctgttcagagctgaataagctctgccagcactttgaggccgtgcactctggcaccccagtcaccaacaacctcctggagaaatgcaaaaccctcgttagccaaagcaacgacttaagcagcctcagagcaaaataccctcatgatgtggtgaaccacctcagctgtgacgaggcccggaaccactacggcggcgtggtcagcctcatccccctcatcctagacttaatgaaagaatggatcgcccactccgagaagttgccgcgcaaggtgctgcagcacgtgagtgagccccaggcgcaccaggagagcaccaggggagccgctcgtcctgcccaggccatagggacccagcccagggccactaaacacaagtgtagacagctcacaaaagccagcctcaaacccaggggatgttcaaaaccaccctggaggcctcctggtgggaaattgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - N-acetylneuraminic acid phosphatase
- cytochrome b-245, alpha polypeptide
- tetratricopeptide repeat domain 33
- troponin T type 1 (skeletal, slow)