NANP-N-acetylneuraminic acid phosphatase Gene View larger

NANP-N-acetylneuraminic acid phosphatase Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NANP-N-acetylneuraminic acid phosphatase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NANP-N-acetylneuraminic acid phosphatase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022552
Product type: DNA & cDNA
Ncbi symbol: NANP
Origin species: Human
Product name: NANP-N-acetylneuraminic acid phosphatase Gene
Size: 2ug
Accessions: BC022552
Gene id: 140838
Gene description: N-acetylneuraminic acid phosphatase
Synonyms: C20orf147; HDHD4; dJ694B14.3; N-acylneuraminate-9-phosphatase; Neu5Ac-9-Pase; haloacid dehalogenase-like hydrolase domain containing 4; haloacid dehalogenase-like hydrolase domain-containing protein 4; N-acetylneuraminic acid phosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggctgagccgcgtgcgggcggttttctttgacttggacaacactctcatcgacacggccggggcgagcaggagaggcatgttggaggtgataaaactcttacaatcaaaataccattataaagaagaggctgaaatcatctgtgataaagttcaagttaaactcagcaaggaatgttttcatccttacaatacatgcattactgatttaaggacttcacattgggaagaagcaatccaggaaacaaaaggtggtgcagccaatagaaaattggctgaagaatgttatttcctttggaaatctacacgtttacagcatatgacactagcagaagacgtcaaagccatgcttactgaacttcgaaaggaggtccgcctacttctattaacgaatggggacagacagacccagagggagaagattgaggcttgtgcctgtcagtcctattttgacgctgttgttgtaggtggagagcagagagaggagaaaccagcaccgtccatattttattactgctgcaatcttctcggagtacaacctggggactgtgtgatggtcggtgacacattagaaaccgacatccaaggaggcctcaatgcaggattgaaagcaacagtctggatcaataaaaatggaatagtgccactgaagtcctccccagttccgcattacatggtttcttctgtgctagagttacctgctctcttacaaagtatagactgcaaagtcagtatgtccacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome b-245, alpha polypeptide
- tetratricopeptide repeat domain 33
- troponin T type 1 (skeletal, slow)
- dickkopf homolog 1 (Xenopus laevis)

Buy NANP-N-acetylneuraminic acid phosphatase Gene now

Add to cart