CYBA-cytochrome b-245, alpha polypeptide Gene View larger

CYBA-cytochrome b-245, alpha polypeptide Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYBA-cytochrome b-245, alpha polypeptide Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYBA-cytochrome b-245, alpha polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028224
Product type: DNA & cDNA
Ncbi symbol: CYBA
Origin species: Human
Product name: CYBA-cytochrome b-245, alpha polypeptide Gene
Size: 2ug
Accessions: BC028224
Gene id: 1535
Gene description: cytochrome b-245, alpha polypeptide
Synonyms: p22-PHOX; cytochrome b-245 light chain; cytochrome b light chain; cytochrome b(558) alpha chain; cytochrome b(558) alpha-subunit; cytochrome b, alpha polypeptide; cytochrome b-245, alpha polypeptide; cytochrome b558 subunit alpha; flavocytochrome b-558 alpha polypeptide; neutrophil cytochrome b 22 kDa polypeptide; p22 phagocyte B-cytochrome; p22phox; superoxide-generating NADPH oxidase light chain subunit; cytochrome b-245 alpha chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcagatcgagtgggccatgtgggccaacgagcaggcgctggcgtccggcctgagtgagtgcacgtcagggacggtggaggctgcagcctggaggggtgtcccaagaccccagccgggacctcgggctacttacagggtggggaagtggggcgccaggcgggccaggccgggccggggtcaggccaggagggtgcggggaacgggggcgggaccctcaggccgcgggctggaaggaggagttctgagacccccagtaattcccttgcagaccctgcggagcgcggcgcccctcccccattcccttctctcggtcccccgactccgcgaaggaggaagttgcagcgcaggggaagaggcggttcagccccggtggtttccggggtcaccgccccgaagcccccgagtgggggctccggcctgggcatcgggagaagctcccctgcccctcggtagccagctggcctggaggtcgctctccctgggcttggggtggggaatgggctcatgccctggggctcagcccttctcatctggagtctgcgctggaggcggtctgagatttcacaaggcgccgaaaccacccagtgacggccctgcccagcccagctgcacaggcactttgctcttggggtgggatggcacagcccccagtcaccctcctgtgcatttgctcagaggttctggtgagggcagcggactccatttggaaatggaccctctcgggaccagggccagggagtgtctggcccagcacgggtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tetratricopeptide repeat domain 33
- troponin T type 1 (skeletal, slow)
- dickkopf homolog 1 (Xenopus laevis)
- mitochondrial ribosomal protein L9

Buy CYBA-cytochrome b-245, alpha polypeptide Gene now

Add to cart