Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CYBA-cytochrome b-245, alpha polypeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYBA-cytochrome b-245, alpha polypeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028224 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYBA |
| Origin species: | Human |
| Product name: | CYBA-cytochrome b-245, alpha polypeptide Gene |
| Size: | 2ug |
| Accessions: | BC028224 |
| Gene id: | 1535 |
| Gene description: | cytochrome b-245, alpha polypeptide |
| Synonyms: | p22-PHOX; cytochrome b-245 light chain; cytochrome b light chain; cytochrome b(558) alpha chain; cytochrome b(558) alpha-subunit; cytochrome b, alpha polypeptide; cytochrome b-245, alpha polypeptide; cytochrome b558 subunit alpha; flavocytochrome b-558 alpha polypeptide; neutrophil cytochrome b 22 kDa polypeptide; p22 phagocyte B-cytochrome; p22phox; superoxide-generating NADPH oxidase light chain subunit; cytochrome b-245 alpha chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggcagatcgagtgggccatgtgggccaacgagcaggcgctggcgtccggcctgagtgagtgcacgtcagggacggtggaggctgcagcctggaggggtgtcccaagaccccagccgggacctcgggctacttacagggtggggaagtggggcgccaggcgggccaggccgggccggggtcaggccaggagggtgcggggaacgggggcgggaccctcaggccgcgggctggaaggaggagttctgagacccccagtaattcccttgcagaccctgcggagcgcggcgcccctcccccattcccttctctcggtcccccgactccgcgaaggaggaagttgcagcgcaggggaagaggcggttcagccccggtggtttccggggtcaccgccccgaagcccccgagtgggggctccggcctgggcatcgggagaagctcccctgcccctcggtagccagctggcctggaggtcgctctccctgggcttggggtggggaatgggctcatgccctggggctcagcccttctcatctggagtctgcgctggaggcggtctgagatttcacaaggcgccgaaaccacccagtgacggccctgcccagcccagctgcacaggcactttgctcttggggtgggatggcacagcccccagtcaccctcctgtgcatttgctcagaggttctggtgagggcagcggactccatttggaaatggaccctctcgggaccagggccagggagtgtctggcccagcacgggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tetratricopeptide repeat domain 33 - troponin T type 1 (skeletal, slow) - dickkopf homolog 1 (Xenopus laevis) - mitochondrial ribosomal protein L9 |