Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TNNT1-troponin T type 1 (skeletal, slow) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNNT1-troponin T type 1 (skeletal, slow) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010963 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNNT1 |
| Origin species: | Human |
| Product name: | TNNT1-troponin T type 1 (skeletal, slow) Gene |
| Size: | 2ug |
| Accessions: | BC010963 |
| Gene id: | 7138 |
| Gene description: | troponin T type 1 (skeletal, slow) |
| Synonyms: | ANM; NEM5; STNT; TNT; TNTS; troponin T, slow skeletal muscle; slow skeletal muscle troponin T; troponin T type 1 (skeletal, slow); troponin-T1, skeletal, slow; troponin T1, slow skeletal type |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggacaccgaggagcaggaatatgaggaggagcagccggaagaggaggctgcggaggaggaggaggaagcccccgaagagccggagccggtggcagagccagaagaggaacgccccaaaccaagccgccccgtggtgcctcctttgatcccgccaaagatcccagaaggggagcgcgttgacttcgatgacatccaccgcaagcgcatggagaaagacctgctggagctgcagacactcatcgatgtacatttcgagcagcggaagaaggaggaagaggagctggttgccttgaaggagcgcattgagcggcgccggtcagagagagccgagcaacagcgcttcagaactgagaaggaacgcgaacgtcaggctaagctggcggaggagaagatgaggaaggaagaggaagaggccaagaagcgggcagaggatgatgccaagaaaaagaaggtgctgtccaacatgggggcccattttggcggctacctggtcaaggcagaacagaagcgtggtaagcggcagacggggcgggagatgaaggtgcgcatcctctccgagcgtaagaagcctctggacattgactacatgggggaggaacagctccgggagaaagcccaggagctgtcggactggatccaccagctggagtctgagaagttcgacctgatggcgaagctgaaacagcagaaatatgagatcaacgtgctgtacaaccgcatcagccacgcccagaagttccggaagggggcagggaagggccgcgttggaggccgctggaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dickkopf homolog 1 (Xenopus laevis) - mitochondrial ribosomal protein L9 - tetratricopeptide repeat domain 19 - arginine/serine-rich coiled-coil 1 |