Login to display prices
Login to display prices
TTC33-tetratricopeptide repeat domain 33 Gene View larger

TTC33-tetratricopeptide repeat domain 33 Gene

PTXBC015701

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTC33-tetratricopeptide repeat domain 33 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TTC33-tetratricopeptide repeat domain 33 Gene

Proteogenix catalog: PTXBC015701
Ncbi symbol: TTC33
Product name: TTC33-tetratricopeptide repeat domain 33 Gene
Size: 2ug
Accessions: BC015701
Gene id: 23548
Gene description: tetratricopeptide repeat domain 33
Synonyms: OSRF; tetratricopeptide repeat protein 33; TPR repeat protein 33; osmosis responsive factor; tetratricopeptide repeat domain 33
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcctttgggtggaagaggaaaattggtgagaaggtctcaaaggtcacttcccagcagtttgaagctgaagctgctgatgagaaggatgtagttgacaacgatgaagggaactggcttcatgccattaaacgtaggaaagaaattcttcttgaaggctgtgctgagaaaagtaaacagctgaaggatgaaggagccagtttggctgaaaataaaagatatcgggaggcaattcagaagtgggatgaagcactacagttaactccaaatgatgctaccctatacgagatgaaatcacaggtgctaatgtctcttcatgaaatgttcccagcagtacatgcagcagaaatggccgtccagcaaaatccacattcatgggagtcttggcagactttgggacgtgctcaacttggtttaggagagataatcctggcaattcgaagttttcaagtagcccttcacatctatccaatgaaccctgaaatatggaaagaagacctctcttgggcaagaacgctccaggagcagcagaaggtagcacagaggattaaaaaaagtgaagcaccagctgaagtaacacacttttcaccaaagtcaattccagactatgactttgaaagtgatgagattgttgctgtttgtgcagctattgctgagaaagagaagacagtttcagcaaataaaacaatggttattgtgtctgcttctggggccatagagactgtaactgaaaaggaggatggtgctacaccaccagatggctctgtttttatcaaagcccgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: