TTC33-tetratricopeptide repeat domain 33 Gene View larger

TTC33-tetratricopeptide repeat domain 33 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TTC33-tetratricopeptide repeat domain 33 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TTC33-tetratricopeptide repeat domain 33 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015701
Product type: DNA & cDNA
Ncbi symbol: TTC33
Origin species: Human
Product name: TTC33-tetratricopeptide repeat domain 33 Gene
Size: 2ug
Accessions: BC015701
Gene id: 23548
Gene description: tetratricopeptide repeat domain 33
Synonyms: OSRF; tetratricopeptide repeat protein 33; TPR repeat protein 33; osmosis responsive factor; tetratricopeptide repeat domain 33
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcttcctttgggtggaagaggaaaattggtgagaaggtctcaaaggtcacttcccagcagtttgaagctgaagctgctgatgagaaggatgtagttgacaacgatgaagggaactggcttcatgccattaaacgtaggaaagaaattcttcttgaaggctgtgctgagaaaagtaaacagctgaaggatgaaggagccagtttggctgaaaataaaagatatcgggaggcaattcagaagtgggatgaagcactacagttaactccaaatgatgctaccctatacgagatgaaatcacaggtgctaatgtctcttcatgaaatgttcccagcagtacatgcagcagaaatggccgtccagcaaaatccacattcatgggagtcttggcagactttgggacgtgctcaacttggtttaggagagataatcctggcaattcgaagttttcaagtagcccttcacatctatccaatgaaccctgaaatatggaaagaagacctctcttgggcaagaacgctccaggagcagcagaaggtagcacagaggattaaaaaaagtgaagcaccagctgaagtaacacacttttcaccaaagtcaattccagactatgactttgaaagtgatgagattgttgctgtttgtgcagctattgctgagaaagagaagacagtttcagcaaataaaacaatggttattgtgtctgcttctggggccatagagactgtaactgaaaaggaggatggtgctacaccaccagatggctctgtttttatcaaagcccgatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - troponin T type 1 (skeletal, slow)
- dickkopf homolog 1 (Xenopus laevis)
- mitochondrial ribosomal protein L9
- tetratricopeptide repeat domain 19

Buy TTC33-tetratricopeptide repeat domain 33 Gene now

Add to cart