RSRC2-arginine/serine-rich coiled-coil 2 Gene View larger

RSRC2-arginine/serine-rich coiled-coil 2 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RSRC2-arginine/serine-rich coiled-coil 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RSRC2-arginine/serine-rich coiled-coil 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008684
Product type: DNA & cDNA
Ncbi symbol: RSRC2
Origin species: Human
Product name: RSRC2-arginine/serine-rich coiled-coil 2 Gene
Size: 2ug
Accessions: BC008684
Gene id: 65117
Gene description: arginine/serine-rich coiled-coil 2
Synonyms: arginine/serine-rich coiled-coil protein 2; arginine/serine-rich coiled-coil 2; arginine and serine rich coiled-coil 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgcacaggaagctttagctagaaggttggaaagggcaaagaaattacaagaacagcgagaaaaggaaatggttgaaaaacaaaaacaacaagaaatagctgcagctgcagctactggaggttctgttctcaatgttgctgccctgttggcatcaggaacacaagtaacacctcagatagccatggcagctcagatggcagccctgcaagctaaagctttggcagagacaggaatagctgttcctagctactataacccagccgctgttaatccaatgaaatttgctgaacaagagaaaaaaaggaaaatgctttggcagggcaagaaagaaggggacaaatcccaatctgctgaaatatgggaaaaattgaattttggaaacaaggaccaaaatgtcaaatttaggaaattgatgggtattaagagtgaagatgaagctggatgtagctcagttgatgaagaaagttacaagactctgaagcagcaggaagaagtatttcgaaatttagatgctcagtatgaaatggcaagatcacaaacccacacacaaagaggaatgggtttgggtttcacatcttcaatgcgaggaatggatgcagtttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 9
- N-acetylneuraminic acid phosphatase
- cytochrome b-245, alpha polypeptide
- tetratricopeptide repeat domain 33

Buy RSRC2-arginine/serine-rich coiled-coil 2 Gene now

Add to cart