Login to display prices
Login to display prices
TNNI1-troponin I type 1 (skeletal, slow) Gene View larger

TNNI1-troponin I type 1 (skeletal, slow) Gene

PTXBC012600

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TNNI1-troponin I type 1 (skeletal, slow) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TNNI1-troponin I type 1 (skeletal, slow) Gene

Proteogenix catalog: PTXBC012600
Ncbi symbol: TNNI1
Product name: TNNI1-troponin I type 1 (skeletal, slow) Gene
Size: 2ug
Accessions: BC012600
Gene id: 7135
Gene description: troponin I type 1 (skeletal, slow)
Synonyms: SSTNI; TNN1; troponin I, slow skeletal muscle; troponin I type 1 (skeletal, slow); troponin I, slow-twitch isoform; troponin I1, slow skeletal type
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccggaagtcgagagaaaacccaagatcactgcctcccgcaaactcttgctgaagagcctgatgctggccaaggccaaggaatgctgggagcaggagcacgaggagcgcgaggctgagaaggtgcgctacctggcagagcgcatccccacgctgcagacccgtggcctgtccctcagtgccctgcaggacctgtgccgggagctgcacgccaaggtggaggtggtggatgaggagcgatacgacattgaggccaaatgcctccacaacaccagggagattaaggacctgaagctgaaggtgatggacctccgtgggaagttcaagcgcccgcccctgcgtcgagtccgtgtctcggctgacgccatgctccgggccctgctgggctccaagcacaaggtgtccatggatctgcgggccaacctcaagtctgtgaagaaggaagacacagagaaggagcggcctgtggaggtgggtgactggaggaagaacgtggaggccatgtctggcatggaaggccggaagaagatgtttgatgccgccaagtctccgacctcacaatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice