Login to display prices
Login to display prices
C2orf7-chromosome 2 open reading frame 7 Gene View larger

C2orf7-chromosome 2 open reading frame 7 Gene

PTXBC005069

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf7-chromosome 2 open reading frame 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf7-chromosome 2 open reading frame 7 Gene

Proteogenix catalog: PTXBC005069
Ncbi symbol: C2orf7
Product name: C2orf7-chromosome 2 open reading frame 7 Gene
Size: 2ug
Accessions: BC005069
Gene id: 84279
Gene description: chromosome 2 open reading frame 7
Synonyms: C2orf7; PAP21; protease-associated domain-containing protein 1; protease-associated domain-containing glycoprotein 21 kDa; protease-associated domain-containing protein of 21 kDa; protease associated domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtccccggcgccgcgggctggtgttgtctcgtgctctggctccccgcgtgcgtcgcggcccacggcttccgtatccatgattatttgtactttcaagtgctgagtcctggggacattcgatacatcttcacagccacacctgccaaggactttggtggtatctttcacacaaggtatgagcagattcaccttgtccccgctgaacctccagaggcctgcggggaactcagcaacggtttcttcatccaggaccagattgctctggtggagagggggggctgctccttcctctccaagactcgggtggtccaggagcacggcgggcgggcggtgatcatctctgacaacgcagttgacaatgacagcttctacgtggagatgatccaggacagtacccagcgcacagctgacatccccgccctcttcctgctcggccgagacggctacatgatccgccgctctctggaacagcatgggctgccatgggccatcatttccatcccagtcaatgtcaccagcatccccacctttgagctgctgcaaccgccctggaccttctggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice