SKP1-S-phase kinase-associated protein 1 Gene View larger

SKP1-S-phase kinase-associated protein 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SKP1-S-phase kinase-associated protein 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SKP1-S-phase kinase-associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025673
Product type: DNA & cDNA
Ncbi symbol: SKP1
Origin species: Human
Product name: SKP1-S-phase kinase-associated protein 1 Gene
Size: 2ug
Accessions: BC025673
Gene id: 6500
Gene description: S-phase kinase-associated protein 1
Synonyms: EMC19; OCP-II; OCP2; SKP1A; TCEB1L; p19A; S-phase kinase-associated protein 1; OCP-2; RNA polymerase II elongation factor-like protein OCP2; SIII; cyclin A/CDK2-associated p19; cyclin-A/CDK2-associated protein p19; organ of Corti protein 2; organ of Corti protein II; p19skp1; transcription elongation factor B polypeptide 1-like; S-phase kinase associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttcaattaagttgcagagttctgatggagagatatttgaagttgatgtggaaattgccaaacaatctgtgactattaagaccatgttggaagatttgggaatggatgatgaaggagatgatgacccagttcctctaccaaatgtgaatgcagcaatattaaaaaaggtcattcagtggtgcacccaccacaaggatgaccctcctcctcctgaagatgatgagaacaaagaaaagcgaacagatgatatccctgtttgggaccaagaattcctgaaagttgaccaaggaacactttttgaactcattctggctgcaaactacttagacatcaaaggtttgcttgatgttacatgcaagactgttgccaatatgatcaaggggaaaactcctgaggagattcgcaagaccttcaatatcaaaaatgactttactgaagaggaggaagcccaggtaggtagcacacagttttgtctttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cold inducible RNA binding protein
- troponin I type 1 (skeletal, slow)
- chromosome 2 open reading frame 7
- BH3 interacting domain death agonist

Buy SKP1-S-phase kinase-associated protein 1 Gene now

Add to cart