LOC153328-similar to CG4995 gene product Gene View larger

LOC153328-similar to CG4995 gene product Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC153328-similar to CG4995 gene product Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LOC153328-similar to CG4995 gene product Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025747
Product type: DNA & cDNA
Ncbi symbol: LOC153328
Origin species: Human
Product name: LOC153328-similar to CG4995 gene product Gene
Size: 2ug
Accessions: BC025747
Gene id: 153328
Gene description: similar to CG4995 gene product
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaagcttccagctggaagactttgcggcgggctggatcggaggtgcagccagtgtcatcgtcggccaccctctggacacagtcaagactcgcctgcaggctggcgttggctacggaaacaccctcagctgcatccgcgtggtgtacaggagggagagtatgttcggcttcttcaagggcatgtccttccccctcgccagcattgccgtctacaactccgtggtgtttggggtcttcagtaacacgcagcggttcctcagccagcaccgctgcggggagccagaggccagtcctccccgcacgctgtcagacctgctcctggccagcatggtggccggcgtggtctctgtcgggctgggagggcccgtggacctcatcaagatccggttgcagatgcagacacaaccgtttcgggacggaggtgaacacaggatgactacagtgttccctgggcctcatctctgcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S-phase kinase-associated protein 1
- cold inducible RNA binding protein
- troponin I type 1 (skeletal, slow)
- chromosome 2 open reading frame 7

Buy LOC153328-similar to CG4995 gene product Gene now

Add to cart