Login to display prices
Login to display prices
LOC153328-similar to CG4995 gene product Gene View larger

LOC153328-similar to CG4995 gene product Gene

PTXBC025747

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LOC153328-similar to CG4995 gene product Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about LOC153328-similar to CG4995 gene product Gene

Proteogenix catalog: PTXBC025747
Ncbi symbol: LOC153328
Product name: LOC153328-similar to CG4995 gene product Gene
Size: 2ug
Accessions: BC025747
Gene id: 153328
Gene description: similar to CG4995 gene product
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaagcttccagctggaagactttgcggcgggctggatcggaggtgcagccagtgtcatcgtcggccaccctctggacacagtcaagactcgcctgcaggctggcgttggctacggaaacaccctcagctgcatccgcgtggtgtacaggagggagagtatgttcggcttcttcaagggcatgtccttccccctcgccagcattgccgtctacaactccgtggtgtttggggtcttcagtaacacgcagcggttcctcagccagcaccgctgcggggagccagaggccagtcctccccgcacgctgtcagacctgctcctggccagcatggtggccggcgtggtctctgtcgggctgggagggcccgtggacctcatcaagatccggttgcagatgcagacacaaccgtttcgggacggaggtgaacacaggatgactacagtgttccctgggcctcatctctgcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice