Login to display prices
Login to display prices
SPP1-secreted phosphoprotein 1 Gene View larger

SPP1-secreted phosphoprotein 1 Gene

PTXBC017387

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPP1-secreted phosphoprotein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPP1-secreted phosphoprotein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017387
Product type: DNA & cDNA
Ncbi symbol: SPP1
Origin species: Human
Product name: SPP1-secreted phosphoprotein 1 Gene
Size: 2ug
Accessions: BC017387
Gene id: 6696
Gene description: secreted phosphoprotein 1
Synonyms: SPP1/CALPHA1 fusion; BNSP; BSPI; ETA-1; OPN; early T-lymphocyte activation 1; nephropontin; osteopontin/immunoglobulin alpha 1 heavy chain constant region fusion protein; secreted phosphoprotein 1 (osteopontin, bone sialoprotein I, early T-lymphocyte activation 1); secreted phosphoprotein 1 variant 6; urinary stone protein; uropontin; secreted phosphoprotein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagaattgcagtgatttgcttttgcctcctaggcatcacctgtgccataccagttaaacaggctgattctggaagttctgaggaaaagcagctttacaacaaatacccagatgctgtggccacatggctaaaccctgacccatctcagaagcagaatctcctagccccacagaatgctgtgtcctctgaagaaaccaatgactttaaacaagagacccttccaagtaagtccaacgaaagccatgaccacatggatgatatggatgatgaagatgatgatgaccatgtggacagccaggactccattgactcgaacgactctgatgatgtagatgacactgatgattctcaccagtctgatgagtctcaccattctgatgaatctgatgaactggtcactgattttcccacggacctgccagcaaccgaagttttcactccagttgtccccacagtagacacatatgatggccgaggtgatagtgtggtttatggactgaggtcaaaatctaagaagtttcgcagacctgacatccagtaccctgatgctacagacgaggacatcacctcacacatggaaagcgaggagttgaatggtgcatacaaggccatccccgttgcccaggacctgaacgcgccttctgattgggacagccgtgggaaggacagttatgaaacgagtcagctggatgaccagagtgctgaaacccacagccacaagcagtccagattatataagcggaaagccaatgatgagagcaatgagcattccgatgtgattgatagtcaggaactttccaaagtcagccgtgaattccacagccatgaatttcacagccatgaagatatgctggttgtagaccccaaaagtaaggaagaagataaacacctgaaatttcgtatttctcatgaattagatagtgcatcttctgaggtcaattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - tectonic family member 3
- cysteine/tyrosine-rich 1
- brix domain containing 5
- stomatin (EPB72)-like 2