STOML2-stomatin (EPB72)-like 2 Gene View larger

STOML2-stomatin (EPB72)-like 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STOML2-stomatin (EPB72)-like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STOML2-stomatin (EPB72)-like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010152
Product type: DNA & cDNA
Ncbi symbol: STOML2
Origin species: Human
Product name: STOML2-stomatin (EPB72)-like 2 Gene
Size: 2ug
Accessions: BC010152
Gene id: 30968
Gene description: stomatin (EPB72)-like 2
Synonyms: HSPC108; SLP-2; stomatin-like protein 2, mitochondrial; EPB72-like 2; EPB72-like protein 2; paraprotein target 7; paratarg-7; stomatin (EPB72)-like 2; stomatin like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggcgcgcgcggcgcggggcactggggcccttttgctgaggggctctctactggcttctggccgcgctccgcgccgcgcctcctctggattgccccgaaacaccgtggtactgttcgtgccgcagcaggaggcctgggtggtggagcgaatgggccgattccaccggatcctggagcctggtttgaacatcctcatccctgtgttagaccggatccgatatgtgcagagtctcaaggaaattgtcatcaacgtgcctgagcagtcggctgtgactctcgacaatgtaactctgcaaatcgatggagtcctttacctgcgcatcatggacccttacaaggcaagctacggtgtggaggaccctgagtatgccgtcacccagccagctcaaacaaccatgagatcagagctcggcaaactctctctggacaaagtcttccgggaacgggagtccctgaatgccagcattgtggatgccatcaaccaagctgctgactgctggggtatccgctgcctccgttatgagatcaaggatatccatgtgccaccccgggtgaaagagtctatgcagatgcaggtggaggcagagcggcggaaacgggccacagttctagagtctgaggggacccgagagtcggccatcaatgtggcagaagggaagaaacaggcccagatcctggcctccgaagcagaaaaggctgaacagataaatcaggcagcaggagaggccagtgcagttctggcgaaggccaaggctaaagctgaagctattcgaatcctggctgcagctctgacacaacataatggagatgcagcagcttcactgactgtggccgagcagtatgtcagcgcgttctccaaactggccaaggactccaacactatcctactgccctccaaccctggcgatgtcaccagcatggtggctcaggccatgggtgtatatggagccctcaccaaagccccagtgccagggactccagactcactctccagtgggagcagcagagatgtccagggtacagatgcaagtcttgatgaggaacttgatcgagtcaagatgagttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - elaC homolog 1 (E. coli)
- AF4/FMR2 family, member 4
- ring finger protein 133
- FGFR1 oncogene partner

Buy STOML2-stomatin (EPB72)-like 2 Gene now

Add to cart