FGFR1OP-FGFR1 oncogene partner Gene View larger

FGFR1OP-FGFR1 oncogene partner Gene

PTXBC011902

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGFR1OP-FGFR1 oncogene partner Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FGFR1OP-FGFR1 oncogene partner Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011902
Product type: DNA & cDNA
Ncbi symbol: FGFR1OP
Origin species: Human
Product name: FGFR1OP-FGFR1 oncogene partner Gene
Size: 2ug
Accessions: BC011902
Gene id: 11116
Gene description: FGFR1 oncogene partner
Synonyms: FGFR1 oncogene partner; fibroblast growth factor receptor 1 oncogene partner
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgacggcggccgcagtggtggccgaggaggacacggagctgcgggacctgctggtgcagacgctggagaacagcggggtcctgaaccgcatcaaggctgaactccgagcagctgtgtttttagcactagaggagcaagaaaaagtagagaacaaaactcctttagttaatgagagcctgagaaagtttttaaataccaaagacggtcgtttagtggctagtcttgttgcagaatttcttcagttttttaaccttgactttactttggctgtttttcaacctgaaactagcacactgcaaggtctcgaaggtcgagagaatttagcccgagatttaggtataattgaagcagaaggtactgtgggtggacccttattattagaagtgatcaggcgctgtcaacagaaagaaaaagggccaaccactggggaaggtgcacttgatctatctgatgtacattctccaccaaagtcaccagagggaaaaacaagtgcacagacaacaccaagtaagaaggccaatgatgaggccaatcagagtgatacaagtgtctccttgtcagaacccaagagcaaaagcagccttcacttactgtcccatgaaacaaaaattggatcttttctaagcaacagaactttagatggcaaagacaaagctggcctttgtccagatgaagatgatatggaaggagattctttctttgatgatcccattcctaagccagagaaaacttacggtttgaggaatgaacctaggaagcaagcaggaagtctggcctcgctctcggatgcaccccccttaaaaagtggactcagctccctggcgggagccccttctttaaaagactctgagagtaaaaggggaaatacagttttgaaagatctgaaattgatcagtgataaaattggatcacttggattaggaactggagaagatgatgactatgttgatgattttaatagtaccagccatcgctcagagaaaagtgagataagtattggtgaagagatagaagaagacctttctgtggaaatagatgacatcaataccagtgataagcttgatgacctcacacaagatctgactgtatcccagctcagtgatgttgcggattatctggaagatgttgcatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger protein 193
- cell adhesion molecule 3
- zinc finger protein 302
- golgi membrane protein 1

Buy FGFR1OP-FGFR1 oncogene partner Gene now

Add to cart