Login to display prices
Login to display prices
AFF4-AF4/FMR2 family, member 4 Gene View larger

AFF4-AF4/FMR2 family, member 4 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AFF4-AF4/FMR2 family, member 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about AFF4-AF4/FMR2 family, member 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025700
Product type: DNA & cDNA
Ncbi symbol: AFF4
Origin species: Human
Product name: AFF4-AF4/FMR2 family, member 4 Gene
Size: 2ug
Accessions: BC025700
Gene id: 27125
Gene description: AF4/FMR2 family, member 4
Synonyms: AF5Q31; CHOPS; MCEF; AF4/FMR2 family member 4; ALL1-fused gene from chromosome 5q31 protein; major CDK9 elongation factor-associated protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccgtgaagaccggaatgtgctgcgtatgaaagaacgggaaaggcggaatcaggaaattcagcagggcgaagacgccttcccacctagctctcctctctttgcagagccatacaaagttactagcaaagaagataagttatcaagtcgtattcagagtatgcttggaaactacgatgaaatgaaggatttcataggagacagatctataccaaagcttgttgcaattcccaagcctacagtaccaccatcagcagatgaaaaatctaacccaaatttctttgaacagagacatggaggctctcatcagagtagcaaatggactccagtaggacccgcacccagcacttctcagtctcagaaacggtcctcaggcttacagagtggacatagtagccagcggaccagcgcaggtagcagtagtggcactaacagtagtggtcagaggcacgaccgtgagtcatataacaatagtgggagcagtagccggaaaaaaggccagcatggatcagaacactccaaatcacgttcttccagccctggaaaaccccaggctgtttcttcattaaactctagtcattccaggtctcatgggaatgatcaccatagcaaggaacatcaacgctccaaatcacctcgggaccctgatgcaaactgggattctccttcccgtgtacctttttcaagtgggcagcactcaactcaatctttcccaccctcattgatgtcaaagtccaattcaatgttacagaaacccactgcctatgtgcggcccatggacggacaggagtccatggaaccaaagctgtcctctgagcactacagcagccaatcccatggcaacagcatgactgagctgaagcccagcagcaaagcacatctcaccaagctgaaaataccttcccaaccactggatgcatcagcttctggtgatgtgagctgtgtggatgaaatcctaaaagagatgacgcattcatggcctccccctctaacggctattcatacaccatgcaaaacagaaccttccaaatttccttttccaactaaggagtctcagcagtccaattttggcactggagaacaaaggctcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 133
- FGFR1 oncogene partner
- zinc finger protein 193
- cell adhesion molecule 3