ELAC1-elaC homolog 1 (E. coli) Gene View larger

ELAC1-elaC homolog 1 (E. coli) Gene

PTXBC014624

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ELAC1-elaC homolog 1 (E. coli) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ELAC1-elaC homolog 1 (E. coli) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014624
Product type: DNA & cDNA
Ncbi symbol: ELAC1
Origin species: Human
Product name: ELAC1-elaC homolog 1 (E. coli) Gene
Size: 2ug
Accessions: BC014624
Gene id: 55520
Gene description: elaC homolog 1 (E. coli)
Synonyms: D29; zinc phosphodiesterase ELAC protein 1; RNase Z 1; RNaseZ(S); deleted in Ma29; elaC homolog 1; elaC homolog protein 1; ribonuclease Z 1; tRNA 3 endonuclease 1; tRNA 3' processing endoribonuclease; tRNA Z (short form); tRNase Z 1; tRNase ZS; elaC ribonuclease Z 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctatggatgtgacattcctggggacgggtgcagcatacccatctccaacccggggtgcctctgctgtggtccttcggtgtgaaggcgagtgctggctctttgactgtggggagggaacacagacacagcttatgaaaagccaacttaaagcagggagaattaccaagatcttcatcacacaccttcatggagaccatttctttggccttcctgggctcctctgcacaatcagcctgcagagtggctccatggtgtccaaacagcctattgaaatctatggccctgtagggcttcgggactttatctggcgaaccatggaactctctcacacggagctggtcttccattatgtggttcatgaactggttcctacagcagatcaatgtcctgcagaagaactaaaagaatttgcgcatgtgaatagagcagacagtcctcccaaagaggaacaaggaagaactatcctgttagactcagaagaaaactcataccttctgtttgatgatgaacaatttgttgtaaaagcatttcgcctctttcacagaattccctcatttgggttttcagtcgtggaaaagaaacgcccaggtaaactcaatgcacagaaacttaaagaccttggtgttccaccaggtcctgcctatgggaagctgaaaaatggaatttctgttgttctggaaaatggggttacaatttctccccaagatgtcttaaaaaagcctattgttggaagaaaaatctgcatattgggtgactgctctggggttgtgggtgatggaggagtaaaactgtgctttgaagcagacctgttgatccacgaagcaaccctggatgatgcccagatggacaaagcaaaggagcatggccacagcacaccacagatggcagcaacatttgcaaagttgtgccgtgcaaagaggctggttctgactcacttcagtcagaggtacaaaccagttgccttggccagagaaggagaaacagatggcattgcagaactaaaaaagcaagctgaatcagtgttagatctccaagaagtgactctagcagaagattttatggtgataagcattccaatcaagaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - AF4/FMR2 family, member 4
- ring finger protein 133
- FGFR1 oncogene partner
- zinc finger protein 193

Buy ELAC1-elaC homolog 1 (E. coli) Gene now

Add to cart