Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CYYR1-cysteine/tyrosine-rich 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CYYR1-cysteine/tyrosine-rich 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036761 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CYYR1 |
| Origin species: | Human |
| Product name: | CYYR1-cysteine/tyrosine-rich 1 Gene |
| Size: | 2ug |
| Accessions: | BC036761 |
| Gene id: | 116159 |
| Gene description: | cysteine/tyrosine-rich 1 |
| Synonyms: | C21orf95; cysteine and tyrosine-rich protein 1; cysteine and tyrosine-rich protein 1 isoform 1,2,2bis,3,4; cysteine and tyrosine-rich protein 1 isoform 1,2,3,4b; cysteine and tyrosine-rich protein 1 isoform 1,2,3b; cysteine and tyrosine-rich protein 1 isoform 1,2,4; cysteine/tyrosine-rich 1; proline-rich domain-containing protein; cysteine and tyrosine rich 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgctccgaggctacccgtgcgtccaggggtcttgcttccgaagttggtcctgctctttgtctacgcagatgattgccttgctcagtgtggcaaagattgcaaatcttactgctgtgatggaaccacgccctactgttgctcctactacgcttatattgggaatatcctctcgggcactgcaattgcgggcattgtttttggaatagtatttatcatgggggtcattgctgggattgccatatgcatctgcatgtgcatgaagaaccacagggcgacccgcgtgggcatcctcaggacgactcacatcaacaccgtctcctcctatcctggaccaccaccctacggtcacgaccacgagatggaatactgtgcagacttgcctcctccatactcccccaccccacagggtccagcacagcgttctccaccccctccttatcctggaaacgcaaggaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - brix domain containing 5 - stomatin (EPB72)-like 2 - elaC homolog 1 (E. coli) - AF4/FMR2 family, member 4 |