CYYR1-cysteine/tyrosine-rich 1 Gene View larger

CYYR1-cysteine/tyrosine-rich 1 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYYR1-cysteine/tyrosine-rich 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYYR1-cysteine/tyrosine-rich 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036761
Product type: DNA & cDNA
Ncbi symbol: CYYR1
Origin species: Human
Product name: CYYR1-cysteine/tyrosine-rich 1 Gene
Size: 2ug
Accessions: BC036761
Gene id: 116159
Gene description: cysteine/tyrosine-rich 1
Synonyms: C21orf95; cysteine and tyrosine-rich protein 1; cysteine and tyrosine-rich protein 1 isoform 1,2,2bis,3,4; cysteine and tyrosine-rich protein 1 isoform 1,2,3,4b; cysteine and tyrosine-rich protein 1 isoform 1,2,3b; cysteine and tyrosine-rich protein 1 isoform 1,2,4; cysteine/tyrosine-rich 1; proline-rich domain-containing protein; cysteine and tyrosine rich 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgctccgaggctacccgtgcgtccaggggtcttgcttccgaagttggtcctgctctttgtctacgcagatgattgccttgctcagtgtggcaaagattgcaaatcttactgctgtgatggaaccacgccctactgttgctcctactacgcttatattgggaatatcctctcgggcactgcaattgcgggcattgtttttggaatagtatttatcatgggggtcattgctgggattgccatatgcatctgcatgtgcatgaagaaccacagggcgacccgcgtgggcatcctcaggacgactcacatcaacaccgtctcctcctatcctggaccaccaccctacggtcacgaccacgagatggaatactgtgcagacttgcctcctccatactcccccaccccacagggtccagcacagcgttctccaccccctccttatcctggaaacgcaaggaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - brix domain containing 5
- stomatin (EPB72)-like 2
- elaC homolog 1 (E. coli)
- AF4/FMR2 family, member 4

Buy CYYR1-cysteine/tyrosine-rich 1 Gene now

Add to cart