Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC16A1-solute carrier family 16, member 1 (monocarboxylic acid transporter 1) Gene
PTXBC045664
New product
Data sheet of SLC16A1-solute carrier family 16, member 1 (monocarboxylic acid transporter 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC16A1-solute carrier family 16, member 1 (monocarboxylic acid transporter 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC045664 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC16A1 |
| Origin species: | Human |
| Product name: | SLC16A1-solute carrier family 16, member 1 (monocarboxylic acid transporter 1) Gene |
| Size: | 2ug |
| Accessions: | BC045664 |
| Gene id: | 6566 |
| Gene description: | solute carrier family 16, member 1 (monocarboxylic acid transporter 1) |
| Synonyms: | HHF7; MCT; MCT1D; monocarboxylate transporter 1; MCT 1; solute carrier family 16 (monocarboxylate transporter), member 1; solute carrier family 16 (monocarboxylic acid transporters), member 1; solute carrier family 16, member 1 (monocarboxylic acid transporter 1); solute carrier family 16 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaccagcagttggaggtccagttggatacacccccccagatggaggctggggctgggcagtggtaattggagctttcatttccatcggcttctcttatgcatttcccaaatcaattactgtcttcttcaaagagattgaaggtatattccatgccaccaccagcgaagtgtcatggatatcctccataatgttggctgtcatgtatggtggaggtcctatcagcagtatcctggtgaataaatatggaagtcgtatagtcatgattgttggtggctgcttgtcaggctgtggcttgattgcagcttctttctgtaacaccgtacagcaactatacgtctgtattggagtcattggaggtcttgggcttgccttcaacttgaatccagctctgaccatgattggcaagtatttctacaagaggcgaccattggccaacggactggccatggcaggcagccctgtgttcctctgtactctggcccccctcaatcaggttttcttcggtatctttggatggagaggaagctttctaattcttgggggcttgctactaaactgctgtgttgctggagccctcatgcgaccaatcgggcccaagccaaccaaggcagggaaagataagtctaaagcatcccttgagaaagctggaaaatctggtgtgaaaaaagatctgcatgatgcaaatacagatcttattggaagacaccctaaacaagagaaacgatcagtcttccaaacaattaatcagttcctggacttaaccctattcacccacagaggctttttgctatacctctctggaaatgtgatcatgttttttggactctttgcacctttggtgtttcttagtagttatgggaagagtcagcattattctagtgagaagtctgccttccttctttccattctggcttttgttgacatggtagcccgaccatctatgggacttgtagccaacacaaagccaataagacctcgaattcagtatttctttgcggcttccgttgttgcaaatggagtgtgtcatatgctagcacctttatccactacctatgttggattctgtgtctatgcgggattctttggatttgccttcgggtggctcagctccgtattgtttgaaacattgatggaccttgttggaccccagaggttctccagcgctgtgggattggtgaccattgtggaatgctgtcctgtcctcctggggccaccacttttaggtatagtatatctccctactaatgtgggtctattacaaaacaagcatgtaagatgggaatgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - anterior pharynx defective 1 homolog A (C. elegans) - leukocyte-associated immunoglobulin-like receptor 1 - APEX nuclease (multifunctional DNA repair enzyme) 1 - serine/threonine kinase receptor associated protein |