APH1A-anterior pharynx defective 1 homolog A (C. elegans) Gene View larger

APH1A-anterior pharynx defective 1 homolog A (C. elegans) Gene

PTXBC008732

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APH1A-anterior pharynx defective 1 homolog A (C. elegans) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APH1A-anterior pharynx defective 1 homolog A (C. elegans) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008732
Product type: DNA & cDNA
Ncbi symbol: APH1A
Origin species: Human
Product name: APH1A-anterior pharynx defective 1 homolog A (C. elegans) Gene
Size: 2ug
Accessions: BC008732
Gene id: 51107
Gene description: anterior pharynx defective 1 homolog A (C. elegans)
Synonyms: APH1A gamma secretase subunit; 6530402N02Rik; APH-1; APH-1A; CGI-78; gamma-secretase subunit APH-1A; anterior pharynx defective 1 homolog A; aph-1alpha; presenilin-stabilization factor; aph-1 homolog A, gamma-secretase subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggggctgcggtgtttttcggctgcactttcgtcgcgttcggcccggccttcgcgcttttcttgatcactgtggctggggacccgcttcgcgttatcatcctggtcgcaggggcatttttctggctggtctccctgctcctggcctctgtggtctggttcatcttggtccatgtgaccgaccggtcagatgcccggctccagtacggcctcctgatttttggtgctgctgtctctgtccttctacaggaggtgttccgctttgcctactacaagctgcttaagaaggcagatgaggggttagcatcgctgagtgaggacggaagatcacccatctccatccgccagatggcctatgtttctggtctctccttcggtatcatcagtggtgtcttctctgttatcaatattttggctgatgcacttgggccaggtgtggttgggatccatggagactcaccctattacttcctgacttcagcctttctgacagcagccattatcctgctccataccttttggggagttgtgttctttgatgcctgtgagaggagacggtactgggctttgggcctggtggttgggagtcacctactgacatcgggactgacattcctgaacccctggtatgaggccagcctgctgcccatctatgcagtcactgtttccatggggctctgggccttcatcacagctggagggtccctccgaagtattcagcgcagcctcttgtgtaaggactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leukocyte-associated immunoglobulin-like receptor 1
- APEX nuclease (multifunctional DNA repair enzyme) 1
- serine/threonine kinase receptor associated protein
- T-cell immunoglobulin and mucin domain containing 4

Buy APH1A-anterior pharynx defective 1 homolog A (C. elegans) Gene now

Add to cart