APEX1-APEX nuclease (multifunctional DNA repair enzyme) 1 Gene View larger

APEX1-APEX nuclease (multifunctional DNA repair enzyme) 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APEX1-APEX nuclease (multifunctional DNA repair enzyme) 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about APEX1-APEX nuclease (multifunctional DNA repair enzyme) 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004979
Product type: DNA & cDNA
Ncbi symbol: APEX1
Origin species: Human
Product name: APEX1-APEX nuclease (multifunctional DNA repair enzyme) 1 Gene
Size: 2ug
Accessions: BC004979
Gene id: 328
Gene description: APEX nuclease (multifunctional DNA repair enzyme) 1
Synonyms: APE; APE1; APEN; APEX; APX; HAP1; REF1; DNA-(apurinic or apyrimidinic site) lyase; AP endonuclease class I; AP lyase; APEX nuclease (multifunctional DNA repair enzyme) 1; apurinic-apyrimidinic endonuclease 1; apurinic/apyrimidinic (abasic) endonuclease; deoxyribonuclease (apurinic or apyrimidinic); protein REF-1; redox factor-1; apurinic/apyrimidinic endodeoxyribonuclease 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgaagcgtgggaaaaagggagcggtggcggaagacggggatgagctcaggacagagccagaggccaagaagagtaagacggccgcaaagaaaaatgacaaagaggcagcaggagagggcccagccctgtatgaggaccccccagatcagaaaacctcacccagtggcaaacctgccacactcaagatctgctcttggaatgtggatgggcttcgagcctggattaagaagaaaggattagattgggtaaaggaagaagccccagatatactgtgccttcaagagaccaaatgttcagagaacaaactaccagctgaacttcaggagctgcctggactctctcatcaatactggtcagctccttcggacaaggaagggtacagtggcgtgggcctgctttcccgccagtgcccactcaaagtttcttacggcataggcgatgaggagcatgatcaggaaggccgggtgattgtggctgaatttgactcgtttgtgctggtaacagcatatgtacctaatgcaggccgaggtctggtacgactggagtaccggcagcgctgggatgaagcctttcgcaagttcctgaagggcctggcttcccgaaagccccttgtgctgtgtggagacctcaatgtggcacatgaagaaattgaccttcgcaaccccaaggggaacaaaaagaatgctggcttcacgccacaagagcgccaaggcttcggggaattactgcaggctgtgccactggctgacagctttaggcacctctaccccaacacaccctatgcctacaccttttggacttatatgatgaatgctcgatccaagaatgttggttggcgccttgattactttttgttgtcccactctctgttacctgcattgtgtgacagcaagatccgttccaaggccctcggcagtgatcactgtcctatcaccctatacctagcactgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - serine/threonine kinase receptor associated protein
- T-cell immunoglobulin and mucin domain containing 4
- kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
- major facilitator superfamily domain containing 10

Buy APEX1-APEX nuclease (multifunctional DNA repair enzyme) 1 Gene now

Add to cart