MFSD10-major facilitator superfamily domain containing 10 Gene View larger

MFSD10-major facilitator superfamily domain containing 10 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MFSD10-major facilitator superfamily domain containing 10 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MFSD10-major facilitator superfamily domain containing 10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001502
Product type: DNA & cDNA
Ncbi symbol: MFSD10
Origin species: Human
Product name: MFSD10-major facilitator superfamily domain containing 10 Gene
Size: 2ug
Accessions: BC001502
Gene id: 10227
Gene description: major facilitator superfamily domain containing 10
Synonyms: TETRAN; TETTRAN; major facilitator superfamily domain-containing protein 10; tetracycline transporter-like protein; major facilitator superfamily domain containing 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggatggggagggggtggaggctgcaccccgcgcccacccatccaccagcagccgccggagcgccgcgtggtcaccgttgtctttctcggcctcctgctggacctcctggccttcacgctgctgctgcccctgctgcccgggctgttggagagccacggccgtgcccacgaccccctctatggctcctggcagggcggggtggactggtttgccaccgccatcgggatgccagtggagaagaggtacaacagtgtcctgttcggaggtctcattggctcggcattctctgtcctgcagtttctgtgtgcgccactcactggggccacctctgactgcttggggaggcgcccggtgatgctgctgtgcctgatgggtgtggccacctcatatgcagtctgggccacctctcggagctttgcggccttcctggcctccaggctgattgggggcatcagcaaagggaacgtcagcctctccacggccatcgttgctgacctgggctcgcctctggcccgcagtcaaggcatggcggtcattggggtggccttctcactgggcttcaccctgggccctatgctcggagcctccctgcccctggaaatggcaccctggtttgccctgctcttcgcagcctccgacctgctgttcatcttctgcttcctgccagagacgctgcccctggagaaacgggcgccctctatcgccctggggttccgtgatgcggctgatctgctcagccccctggccctgctgcgcttctcggctgtcgctcgtggccaggacccaccctctggagacaggctcagcagcctgcgccgcctgggcctagtctacttcctctacctcttcctgttctcgggcctggagtacacgctgagcttcctcacacaccagcgcttccagttcagtagcctacagcaggggaagatgtttttcctcatcggcctcaccatggccaccatccagggtgcctatgcccggcggatccaccctggcggggaagttgctgccgtgaagcgggccctcctgctgctggtgcccgccttcctcctcatcggctggggacgttctctgcccgtgctgggcctggggctgctgctctactcctttgccgccgccgttgtggtgccctgcctgtcctccgtggtcgctggctatggctcaccagggcagaagggcacggtcatgggtacactgcgcagcctaggtgctctggccagggccgcggggcccctggtggccgcttcagtgtactggctggccggggcccaggcctgcttcaccacgtggtccgggctctttttgctccccttcttcctcctgcagaagctgagttacccggcacagacgctcaaggctgagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - major facilitator superfamily domain containing 10
- eukaryotic translation elongation factor 1 alpha 1
- gamma-aminobutyric acid (GABA) A receptor, alpha 5
- matrix metallopeptidase 1 (interstitial collagenase)

Buy MFSD10-major facilitator superfamily domain containing 10 Gene now

Add to cart