EEF1A1-eukaryotic translation elongation factor 1 alpha 1 Gene View larger

EEF1A1-eukaryotic translation elongation factor 1 alpha 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EEF1A1-eukaryotic translation elongation factor 1 alpha 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about EEF1A1-eukaryotic translation elongation factor 1 alpha 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008587
Product type: DNA & cDNA
Ncbi symbol: EEF1A1
Origin species: Human
Product name: EEF1A1-eukaryotic translation elongation factor 1 alpha 1 Gene
Size: 2ug
Accessions: BC008587
Gene id: 1915
Gene description: eukaryotic translation elongation factor 1 alpha 1
Synonyms: CCS-3; CCS3; EE1A1; EEF-1; EEF1A; EF-Tu; EF1A; GRAF-1EF; HNGC:16303; LENG7; PTI1; eEF1A-1; elongation factor 1-alpha 1; CTCL tumor antigen; EF-1-alpha-1; EF1a-like protein; cervical cancer suppressor 3; elongation factor 1 alpha subunit; elongation factor Tu; eukaryotic elongation factor 1 A-1; eukaryotic translation elongation factor 1 alpha 1-like 14; glucocorticoid receptor AF-1 specific elongation factor; leukocyte receptor cluster (LRC) member 7; leukocyte receptor cluster member 7; prostate tumor-inducing protein 1; translation elongation factor 1 alpha 1-like 14; eukaryotic translation elongation factor 1 alpha 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaaaggaaaagactcatatcaacattgtcgtcattggacacgtagattcgggcaagtccaccactactggccatctgatctataaatgcggtggcatcgacaaaagaaccattgaaaaatttgagaaggaggctgctgagatgggaaagggctccttcaagtatgcctgggtcttggataaactgaaagctgagcgtgaacgtggtatcaccattgatatctccttgtggaaatttgagaccagcaagtactatgtgactatcattgatgccccaggacacagagactttatcaaaaacatgattacagggacatctcaggctgactgtgctgtcctgattgttgctgctggtgttggtgaatttgaagctggtatctccaagaatgggcagacccgagagcatgcccttctggcttacacactgggtgtgaaacaactaattgtcggtgttaacaaaatggattccactgagccaccctacagccagaagagatatgaggaaattgttaaggaagtcagcacttacattaagaaaattggctacaaccccgacacagtagcatttgtgccaatttctggttggaatggtgacaacatgctggagccaagtgctaacatgccttggttcaagggatggaaagtcacccgtaaggatggcaatgccagtggaaccacgctgcttgaggctctggactgcatcctaccaccaactcgtccaactgacaagcccttgcgcctgcctctccaggatgtctacaaaattggtggtattggtactgttcctgttggccgagtggagactggtgttctcaaacccggtatggtggtcacctttgctccagtcaacgttacaacggaagtaaaatctgtcgaaatgcaccatgaagctttgagtgaagctcttcctggggacaatgtgggcttcaatgtcaagaatgtgtctgtcaaggatgttcgtcgtggcaacgttgctggtgacagcaaaaatgacccaccaatggaagcagctggcttcactgctcaggtgattatcctgaaccatccaggccaaataagcgccggctatgcccctgtattggattgccacacggctcacattgcatgcaagtttgctgagctgaaggaaaagattgatcgccgttctggtaaaaagctggaagatggccctaaattcttgaagtctggtgatgctgccattgttgatatggttcctggcaagcccatgtgtgttgagagcttctcagactatccacctttgggtcgctttgctgttcgtgatatgagacagacagttgcggtgggtgtcatcaaagcagtggacaagaaggctgctggagctggcaaggtcaccaagtctgcccagaaagctcagaaggctaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - gamma-aminobutyric acid (GABA) A receptor, alpha 5
- matrix metallopeptidase 1 (interstitial collagenase)
- pre-B-cell leukemia homeobox interacting protein 1
- ubiquitin related modifier 1 homolog (S. cerevisiae)

Buy EEF1A1-eukaryotic translation elongation factor 1 alpha 1 Gene now

Add to cart