URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene View larger

URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene

PTXBC011620

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011620
Product type: DNA & cDNA
Ncbi symbol: URM1
Origin species: Human
Product name: URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011620
Gene id: 81605
Gene description: ubiquitin related modifier 1 homolog (S. cerevisiae)
Synonyms: C9orf74; ubiquitin-related modifier 1; ubiquitin-related modifier 1 homolog; ubiquitin related modifier 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgcccttgtcagtggaggtggagttcggaggtggtgcggagctcctgtttgacggtattaagaaacatcgagtcactttgcctggacaggaggaaccctgggacatccggaacctgctcatctggatcaagaagaatttgctaaaagagcggccagagttgttcatccagggagacagcgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - blocked early in transport 1 homolog (S. cerevisiae)
- TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
- prostate transmembrane protein, androgen induced 1
- alcohol dehydrogenase 5 (class III), chi polypeptide

Buy URM1-ubiquitin related modifier 1 homolog (S. cerevisiae) Gene now

Add to cart