PMEPA1-prostate transmembrane protein, androgen induced 1 Gene View larger

PMEPA1-prostate transmembrane protein, androgen induced 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PMEPA1-prostate transmembrane protein, androgen induced 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PMEPA1-prostate transmembrane protein, androgen induced 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015918
Product type: DNA & cDNA
Ncbi symbol: PMEPA1
Origin species: Human
Product name: PMEPA1-prostate transmembrane protein, androgen induced 1 Gene
Size: 2ug
Accessions: BC015918
Gene id: 56937
Gene description: prostate transmembrane protein, androgen induced 1
Synonyms: STAG1; TMEPAI; protein TMEPAI; solid tumor-associated 1 protein; transmembrane, prostate androgen induced RNA; prostate transmembrane protein, androgen induced 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatggtgatggtggtggtgatcacgtgcctgctgagccactacaagctgtctgcacggtccttcatcagccggcacagccaggggcggaggagagaagatgccctgtcctcagaaggatgcctgtggccctcggagagcacagtgtcaggcaacggaatcccagagccgcaggtctacgccccgcctcggcccaccgaccgcctggccgtgccgcccttcgcccagcgggagcgcttccaccgcttccagcccacctatccgtacctgcagcacgagatcgacctgccgcccaccatctcgctgtcagacggggaggagcccccaccctaccagggcccctgcaccctccagcttcgggaccccgagcagcagctggaactgaaccgggagtcggtgcgcgcacccccaaacagaaccatcttcgacagtgacctgatggatagtgccaggctgggcggcccctgcccccccagcagtaactcgggcatcagcgccacgtgctacggcagcggcgggcgcatggaggggccgccgcccacctacagcgaggtcatcggccactacccggggtcctccttccagcaccagcagagcagtgggccgccctccttgctggaggggacccggctccaccacacacacatcgcgcccctagagagcgcagccatctggagcaaagagaaggataaacagaaaggacaccctctctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - alcohol dehydrogenase 5 (class III), chi polypeptide
- glucocorticoid modulatory element binding protein 1
- vacuolar protein sorting 53 homolog (S. cerevisiae)
- ATPase, H+ transporting, lysosomal V0 subunit a1

Buy PMEPA1-prostate transmembrane protein, androgen induced 1 Gene now

Add to cart