TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene View larger

TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011825
Product type: DNA & cDNA
Ncbi symbol: TSR2
Origin species: Human
Product name: TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC011825
Gene id: 90121
Gene description: TSR2, 20S rRNA accumulation, homolog (S. cerevisiae)
Synonyms: TSR2, ribosome maturation factor; TSR2, 20S rRNA accumulation, homolog; pre-rRNA-processing protein TSR2 homolog; DBA14; DT1P1A10; WGG1; WGG motif containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgggcgctgcagaagatgcgcgagctcttttccgggctggggtctgcgcggccctggaggcctggccggccttgcagatcgctgtggagaatggcttcgggggtgtgcacagccaggagaaggccaagtggctggggggtgcagtggaggattacttcatgcgcaatgctgacttggagctagatgaggtggaagacttccttggagagctgttgaccaacgagtttgatacagttgtggaagacgggagtctgccccaggtgagccagcaactgcagaccatgttccaccacttccagaggggtgatggggctgctctgagggagatggcctcctgcatcactcagagaaaatgcaaggtcacagccactgcacttaagacagctagagagactgatgaggatgaagatgatgtggacagtgtggaagagatggaggtcacagctacgaatgatggggctgctacagatggggtctgcccccagcctgaaccctctgatccagacgctcagactattaaggaagaggatatagtggaagatggctggaccattgtccggagaaaaaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - prostate transmembrane protein, androgen induced 1
- alcohol dehydrogenase 5 (class III), chi polypeptide
- glucocorticoid modulatory element binding protein 1
- vacuolar protein sorting 53 homolog (S. cerevisiae)

Buy TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene now

Add to cart