Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene
PTXBC011825
New product
Data sheet of TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011825 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSR2 |
| Origin species: | Human |
| Product name: | TSR2-TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC011825 |
| Gene id: | 90121 |
| Gene description: | TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) |
| Synonyms: | TSR2, ribosome maturation factor; TSR2, 20S rRNA accumulation, homolog; pre-rRNA-processing protein TSR2 homolog; DBA14; DT1P1A10; WGG1; WGG motif containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgggcgctgcagaagatgcgcgagctcttttccgggctggggtctgcgcggccctggaggcctggccggccttgcagatcgctgtggagaatggcttcgggggtgtgcacagccaggagaaggccaagtggctggggggtgcagtggaggattacttcatgcgcaatgctgacttggagctagatgaggtggaagacttccttggagagctgttgaccaacgagtttgatacagttgtggaagacgggagtctgccccaggtgagccagcaactgcagaccatgttccaccacttccagaggggtgatggggctgctctgagggagatggcctcctgcatcactcagagaaaatgcaaggtcacagccactgcacttaagacagctagagagactgatgaggatgaagatgatgtggacagtgtggaagagatggaggtcacagctacgaatgatggggctgctacagatggggtctgcccccagcctgaaccctctgatccagacgctcagactattaaggaagaggatatagtggaagatggctggaccattgtccggagaaaaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - prostate transmembrane protein, androgen induced 1 - alcohol dehydrogenase 5 (class III), chi polypeptide - glucocorticoid modulatory element binding protein 1 - vacuolar protein sorting 53 homolog (S. cerevisiae) |