TIMD4-T-cell immunoglobulin and mucin domain containing 4 Gene View larger

TIMD4-T-cell immunoglobulin and mucin domain containing 4 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TIMD4-T-cell immunoglobulin and mucin domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about TIMD4-T-cell immunoglobulin and mucin domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008988
Product type: DNA & cDNA
Ncbi symbol: TIMD4
Origin species: Human
Product name: TIMD4-T-cell immunoglobulin and mucin domain containing 4 Gene
Size: 2ug
Accessions: BC008988
Gene id: 91937
Gene description: T-cell immunoglobulin and mucin domain containing 4
Synonyms: SMUCKLER; TIM4; T-cell immunoglobulin and mucin domain-containing protein 4; T-cell immunoglobulin mucin receptor 4; T-cell membrane protein 4; TIM-4; TIMD-4; T-cell immunoglobulin and mucin domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccaaagaacctctcattctctggctgatgattgagttttggtggctttacctgacaccagtcacttcagagactgttgtgacggaggttttgggtcaccgggtgactttgccctgtctgtactcatcctggtctcacaacagcaacagcatgtgctgggggaaagaccagtgcccctactccggttgcaaggaggcgctcatccgcactgatggaatgagggtgacctcaagaaagtcagcaaaatatagacttcaggggactatcccgagaggtgatgtctccttgaccatcttaaaccccagtgaaagtgacagcggtgtgtactgctgccgcatagaagtgcctggctggttcaacgatgtaaagataaacgtgcgcctgaatctacagagagcctcaacaaccacgcacagaacagcaaccaccaccacacgcagaacaacaacaacaagccccaccaccacccgacaaatgacaacaaccccagctgcacttccaacaacagtcgtgaccacacccgatctcacaaccggaacaccactccagatgacaaccattgccgtcttcacaacagcaaacacgtgcctttcactaaccccaagcacccttccggaggaagccacaggtcttctgactcccgagccttctaaggaagggcccatcctcactgcagaatcagaaactgtcctccccagtgattcctggagtagtgctgagtctacttctgctgacactgtcctgctgacatccaaagagtccaaagtttgggatctcccatcaacatcccacgtgtcaatgtggaaaacgagtgattctgtgtcttctcctcagcctggagcatctgatacagcagttcctgagcagaacaaaacaacaaaaacaggacagatggatggaatacccatgtcaatgaagaatgaaatgcccatctcccaactactgatgatcatcgccccctccttgggatttgtgctcttcgcattgtttgtggcgtttctcctgagagggaaactcatggaaacctattgttcgcagaaacacacaaggctagactacattggagatagtaaaaatgtcctcaatgacgtgcagcatggaagggaagacgaagacggcctttttaccctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)
- major facilitator superfamily domain containing 10
- major facilitator superfamily domain containing 10
- eukaryotic translation elongation factor 1 alpha 1

Buy TIMD4-T-cell immunoglobulin and mucin domain containing 4 Gene now

Add to cart