Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene
PTXBC027899
New product
Data sheet of LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LAIR1 |
| Origin species: | Human |
| Product name: | LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene |
| Size: | 2ug |
| Accessions: | BC027899 |
| Gene id: | 3903 |
| Gene description: | leukocyte-associated immunoglobulin-like receptor 1 |
| Synonyms: | CD305; LAIR-1; leukocyte-associated immunoglobulin-like receptor 1; immunoglobulin heavy chain variable region; leukocyte-associated Ig-like receptor 1; leukocyte associated immunoglobulin like receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctccccaccccaccgccctcctgggcctagtgctctgcctggcccagaccatccacacgcaggaggaagatctgcccagaccctccatctcggctgagccaggcaccgtgatccccctggggagccatgtgactttcgtgtgccggggcccggttggggttcaaacattccgcctggagagggagagtagatccacatacaatgatactgaagatgtgtctcaagctagtccatctgagtcagaggccagattccgcattgactcagtaagtgaaggaaatgccgggccttatcgctgcatctattataagccccctaaatggtctgagcagagtgactacctggagctgctggtgaaagaaacctctggaggcccggactccccggacacagagcccggctcctcagctggacccacgcagaggccgtcggacaacagtcacaatgagcatgcacctgcttcccaaggcctgaaagctgagcatctgtatattctcatcggggtctcagtggtcttcctcttctgtctcctcctcctggtcctcttctgcctccatcgccagaatcagataaagcaggggccccccagaagcaaggacgaggagcagaagccacagcagaggcctgacctggctgttgatgttctagagaggacagcagacaaggccacagtcaatggacttcctgagaaggacagagagacggacacctcggccctggctgcagggagttcccaggaggtgacgtatgctcagctggaccactgggccctcacacagaggacagcccgggctgtgtccccacagtccacaaagcccatggccgagtccatcacgtatgcagccgttgccagacactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - APEX nuclease (multifunctional DNA repair enzyme) 1 - serine/threonine kinase receptor associated protein - T-cell immunoglobulin and mucin domain containing 4 - kynurenine 3-monooxygenase (kynurenine 3-hydroxylase) |