LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene View larger

LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027899
Product type: DNA & cDNA
Ncbi symbol: LAIR1
Origin species: Human
Product name: LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene
Size: 2ug
Accessions: BC027899
Gene id: 3903
Gene description: leukocyte-associated immunoglobulin-like receptor 1
Synonyms: CD305; LAIR-1; leukocyte-associated immunoglobulin-like receptor 1; immunoglobulin heavy chain variable region; leukocyte-associated Ig-like receptor 1; leukocyte associated immunoglobulin like receptor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctccccaccccaccgccctcctgggcctagtgctctgcctggcccagaccatccacacgcaggaggaagatctgcccagaccctccatctcggctgagccaggcaccgtgatccccctggggagccatgtgactttcgtgtgccggggcccggttggggttcaaacattccgcctggagagggagagtagatccacatacaatgatactgaagatgtgtctcaagctagtccatctgagtcagaggccagattccgcattgactcagtaagtgaaggaaatgccgggccttatcgctgcatctattataagccccctaaatggtctgagcagagtgactacctggagctgctggtgaaagaaacctctggaggcccggactccccggacacagagcccggctcctcagctggacccacgcagaggccgtcggacaacagtcacaatgagcatgcacctgcttcccaaggcctgaaagctgagcatctgtatattctcatcggggtctcagtggtcttcctcttctgtctcctcctcctggtcctcttctgcctccatcgccagaatcagataaagcaggggccccccagaagcaaggacgaggagcagaagccacagcagaggcctgacctggctgttgatgttctagagaggacagcagacaaggccacagtcaatggacttcctgagaaggacagagagacggacacctcggccctggctgcagggagttcccaggaggtgacgtatgctcagctggaccactgggccctcacacagaggacagcccgggctgtgtccccacagtccacaaagcccatggccgagtccatcacgtatgcagccgttgccagacactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - APEX nuclease (multifunctional DNA repair enzyme) 1
- serine/threonine kinase receptor associated protein
- T-cell immunoglobulin and mucin domain containing 4
- kynurenine 3-monooxygenase (kynurenine 3-hydroxylase)

Buy LAIR1-leukocyte-associated immunoglobulin-like receptor 1 Gene now

Add to cart