SLC25A36-solute carrier family 25, member 36 Gene View larger

SLC25A36-solute carrier family 25, member 36 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A36-solute carrier family 25, member 36 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A36-solute carrier family 25, member 36 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014064
Product type: DNA & cDNA
Ncbi symbol: SLC25A36
Origin species: Human
Product name: SLC25A36-solute carrier family 25, member 36 Gene
Size: 2ug
Accessions: BC014064
Gene id: 55186
Gene description: solute carrier family 25, member 36
Synonyms: PNC2; solute carrier family 25 member 36; solute carrier family 25 (pyrimidine nucleotide carrier ), member 36
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccagagggacacgctggtgcatctgtttgccggaggatgtggtggtacagtgggagctattctgacatgtccactggaagttgtaaaaacacgactgcagtcatcttctgtgacgctttatatttctgaagttcagctgaacaccatggctggagccagtgtcaaccgagtagtgtctcccggacctcttcattgcctaaaggtgatcttggaaaaagaagggcctcgttccttgtttagaggactaggccccaatttagtgggggtagccccttccagagcaatatactttgctgcttattcaaactgcaaggaaaagttgaatgatgtatttgatcctgattctacccaagtacatatgatttcagctgcaatggcaggttttactgcaatcacagcaaccaaccccatttggcttataaagactcggttacagcttgatgcaaggaaccgcggggaaaggcgaatgggtgcttttgaatgtgttcgtaaagtgtatcagacagatggactaaaaggattttataggggcatgtctgcttcatatgctggtatatcagagactgttatccattttgttatttatgaaagtataaaacaaaaactactggaatataagactgcttctacaatggaaaatgatgaagagtctgtgaaagaagcatcagattttgtgggaatgatgctagctgctgccacctcaaaaacttgtgccacaactatagcatatccacatgaagttgtaagaacaagactacgtgaagagggaacaaaatacagatctttttttcagactctatctttgcttgttcaagaagaaggttatgggtctctttatcgtggtctgacaactcatctagtgagacagattccaaacacagccattatgatggccacctatgaattggtggtttacctactcaatggatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - solute carrier family 25, member 32
- immunoglobulin lambda variable 6-57
- chromosome 13 open reading frame 16
- chromosome 19 open reading frame 57

Buy SLC25A36-solute carrier family 25, member 36 Gene now

Add to cart