Cart 32 Product Products 4 057,70 € (empty)
-
1 x INS-insuli...113,40 € -
1 x Chicken...239,00 € -
1 x Chicken...311,00 € -
1 x PRPSAP1-ph...121,50 € -
1 x C4orf30-ch...113,40 € -
-
1 x RPL28-ribo...113,40 € -
1 x SCTR-secre...121,50 € -
1 x KIAA1602-K...113,40 € -
1 x LATS1-LATS...113,40 € -
1 x KU-MEL-3-K...113,40 € -
-
-
1 x Chicken...259,00 € -
1 x CBR4-carbo...113,40 € -
1 x CIDEA-cell...113,40 € -
1 x FAM133B-fa...113,40 € -
1 x C6orf201-c...113,40 € -
-
-
1 x RPS2-ribos...121,50 € -
1 x TMEM37-tra...113,40 € -
1 x C2orf80-ch...113,40 € -
-
1 x Goat...190,24 € -
1 x Goat...197,00 € -
1 x KLHDC9-kel...113,40 € -
1 x A4GALT-alp...121,50 € -
1 x TMEM167A-t...113,40 € -
1 x LAPTM4A-ly...113,40 € -
-
No products
To be determined Shipping
4 057,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 057,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 057,70 €
View larger 
Data sheet of SLC25A36-solute carrier family 25, member 36 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A36-solute carrier family 25, member 36 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014064 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A36 |
| Origin species: | Human |
| Product name: | SLC25A36-solute carrier family 25, member 36 Gene |
| Size: | 2ug |
| Accessions: | BC014064 |
| Gene id: | 55186 |
| Gene description: | solute carrier family 25, member 36 |
| Synonyms: | PNC2; solute carrier family 25 member 36; solute carrier family 25 (pyrimidine nucleotide carrier ), member 36 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccagagggacacgctggtgcatctgtttgccggaggatgtggtggtacagtgggagctattctgacatgtccactggaagttgtaaaaacacgactgcagtcatcttctgtgacgctttatatttctgaagttcagctgaacaccatggctggagccagtgtcaaccgagtagtgtctcccggacctcttcattgcctaaaggtgatcttggaaaaagaagggcctcgttccttgtttagaggactaggccccaatttagtgggggtagccccttccagagcaatatactttgctgcttattcaaactgcaaggaaaagttgaatgatgtatttgatcctgattctacccaagtacatatgatttcagctgcaatggcaggttttactgcaatcacagcaaccaaccccatttggcttataaagactcggttacagcttgatgcaaggaaccgcggggaaaggcgaatgggtgcttttgaatgtgttcgtaaagtgtatcagacagatggactaaaaggattttataggggcatgtctgcttcatatgctggtatatcagagactgttatccattttgttatttatgaaagtataaaacaaaaactactggaatataagactgcttctacaatggaaaatgatgaagagtctgtgaaagaagcatcagattttgtgggaatgatgctagctgctgccacctcaaaaacttgtgccacaactatagcatatccacatgaagttgtaagaacaagactacgtgaagagggaacaaaatacagatctttttttcagactctatctttgcttgttcaagaagaaggttatgggtctctttatcgtggtctgacaactcatctagtgagacagattccaaacacagccattatgatggccacctatgaattggtggtttacctactcaatggatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25, member 32 - immunoglobulin lambda variable 6-57 - chromosome 13 open reading frame 16 - chromosome 19 open reading frame 57 |