Login to display prices
Login to display prices
SLC25A36-solute carrier family 25, member 36 Gene View larger

SLC25A36-solute carrier family 25, member 36 Gene

PTXBC014064

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A36-solute carrier family 25, member 36 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A36-solute carrier family 25, member 36 Gene

Proteogenix catalog: PTXBC014064
Ncbi symbol: SLC25A36
Product name: SLC25A36-solute carrier family 25, member 36 Gene
Size: 2ug
Accessions: BC014064
Gene id: 55186
Gene description: solute carrier family 25, member 36
Synonyms: PNC2; solute carrier family 25 member 36; solute carrier family 25 (pyrimidine nucleotide carrier ), member 36
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccagagggacacgctggtgcatctgtttgccggaggatgtggtggtacagtgggagctattctgacatgtccactggaagttgtaaaaacacgactgcagtcatcttctgtgacgctttatatttctgaagttcagctgaacaccatggctggagccagtgtcaaccgagtagtgtctcccggacctcttcattgcctaaaggtgatcttggaaaaagaagggcctcgttccttgtttagaggactaggccccaatttagtgggggtagccccttccagagcaatatactttgctgcttattcaaactgcaaggaaaagttgaatgatgtatttgatcctgattctacccaagtacatatgatttcagctgcaatggcaggttttactgcaatcacagcaaccaaccccatttggcttataaagactcggttacagcttgatgcaaggaaccgcggggaaaggcgaatgggtgcttttgaatgtgttcgtaaagtgtatcagacagatggactaaaaggattttataggggcatgtctgcttcatatgctggtatatcagagactgttatccattttgttatttatgaaagtataaaacaaaaactactggaatataagactgcttctacaatggaaaatgatgaagagtctgtgaaagaagcatcagattttgtgggaatgatgctagctgctgccacctcaaaaacttgtgccacaactatagcatatccacatgaagttgtaagaacaagactacgtgaagagggaacaaaatacagatctttttttcagactctatctttgcttgttcaagaagaaggttatgggtctctttatcgtggtctgacaactcatctagtgagacagattccaaacacagccattatgatggccacctatgaattggtggtttacctactcaatggatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: