SLC25A32-solute carrier family 25, member 32 Gene View larger

SLC25A32-solute carrier family 25, member 32 Gene

PTXBC021893

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A32-solute carrier family 25, member 32 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A32-solute carrier family 25, member 32 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC021893
Product type: DNA & cDNA
Ncbi symbol: SLC25A32
Origin species: Human
Product name: SLC25A32-solute carrier family 25, member 32 Gene
Size: 2ug
Accessions: BC021893
Gene id: 81034
Gene description: solute carrier family 25, member 32
Synonyms: MFT; MFTC; RREI; mitochondrial folate transporter/carrier; solute carrier family 25 (mitochondrial folate carrier), member 32; solute carrier family 25 member 32
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacgggccagggccagtcggcgtccgggtcgtcggcgtggagcacggtattccgccacgtccggtatgagaacctgatagcgggcgtgagcggcggcgtcttatccaaccttgcgctgcatccgctcgacctcgtgaagatccgcttcgccgtgagtgatggattggaactgagaccgaaatataatggaattttacattgcttgactaccatttggaaacttgatggactacggggactttatcaaggagtaaccccaaatatatggggtgcaggtttatcctggggactctactttttcttttacaatgccatcaagtcatataaaacagaaggaagagctgaacgtttagaggcaacagaataccttgtctcagctgctgaagctggagccatgaccctctgcattacaaacccattatgggtaacaaaaactcgccttatgttacagtatgatgctgttgttaactccccacaccgacaatataaaggaatgtttgatacacttgtgaaaatatataagtatgaaggtgtgcgtggattatataagggatttgttcctgggctgtttggaacatcgcatggtgcccttcagtttatggcatatgaattgctgaagttgaagtacaaccagcatatcaatagattaccagaagcccagttgagcacagtagaatatatatctgttgcagcactatccaaaatatttgctgtcgcagcaacatacccatatcaagtcgtaagagctcgtcttcaggatcaacacatgttttacagtggtgtaatagatgtaatcacaaagacatggaggaaagaaggcgtcggtggattttacaagggaattgctcctaatttgattagagtgactccagcctgctgtattacctttgtggtatatgaaaacgtctcacattttttacttgaccttagagaaaagagaaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - immunoglobulin lambda variable 6-57
- chromosome 13 open reading frame 16
- chromosome 19 open reading frame 57
- Fas (TNF receptor superfamily, member 6)

Buy SLC25A32-solute carrier family 25, member 32 Gene now

Add to cart