FAS-Fas (TNF receptor superfamily, member 6) Gene View larger

FAS-Fas (TNF receptor superfamily, member 6) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAS-Fas (TNF receptor superfamily, member 6) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAS-Fas (TNF receptor superfamily, member 6) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012479
Product type: DNA & cDNA
Ncbi symbol: FAS
Origin species: Human
Product name: FAS-Fas (TNF receptor superfamily, member 6) Gene
Size: 2ug
Accessions: BC012479
Gene id: 355
Gene description: Fas (TNF receptor superfamily, member 6)
Synonyms: Fas cell surface death receptor; apoptosis-mediating surface antigen FAS; apoptosis signaling receptor FAS; Fas AMA; Fas (TNF receptor superfamily, member 6); ALPS1A; APO-1; APT1; CD95; FAS1; FASTM; TNFRSF6; tumor necrosis factor receptor superfamily member 6; APO-1 cell surface antigen; CD95 antigen; FASLG receptor; TNF receptor superfamily member 6; apoptosis antigen 1; mutant tumor necrosis receptor superfamily member 6; tumor necrosis factor receptor superfamily, member 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggcatctggaccctcctacctctggttcttacgtctgttgctagattatcgtccaaaagtgttaatgcccaagtgactgacatcaactccaagggattggaattgaggaagactgttactacagttgagactcagaacttggaaggcctgcatcatgatggccaattctgccataagccctgtcctccaggtgaaaggaaagctagggactgcacagtcaatggggatgaaccagactgcgtgccctgccaagaagggaaggagtacacagacaaagcccatttttcttccaaatgcagaagatgtagattgtgtgatgaaggacatggcttagaagtggaaataaactgcacccggacccagaataccaagtgcagatgtaaaccaaactttttttgtaactctactgtatgtgaacactgtgacccttgcaccaaatgtgaacatggaatcatcaaggaatgcacactcaccagcaacaccaagtgcaaagaggaaggatccagatctaacttggggtggctttgtcttcttcttttgccaattccactaattgtttgggtgaagagaaaggaagtacagaaaacatgcagaaagcacagaaaggaaaaccaaggttctcatgaatctccaaccttaaatcctgaaacagtggcaataaatttatctgatgttgacttgagtaaatatatcaccactattgctggagtcatgacactaagtcaagttaaaggctttgttcgaaagaatggtgtcaatgaagccaaaatagatgagatcaagaatgacaatgtccaagacacagcagaacagaaagttcaactgcttcgtaattggcatcaacttcatggaaagaaagaagcgtatgacacattgattaaagatctcaaaaaagccaatctttgtactcttgcagagaaaattcagactatcatcctcaaggacattactagtgactcagaaaattcaaacttcagaaatgaaatccaaagcttggtctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 11 open reading frame 49
- solute carrier family 25, member 40
- chromosome 18 open reading frame 22
- germinal center expressed transcript 2

Buy FAS-Fas (TNF receptor superfamily, member 6) Gene now

Add to cart