Login to display prices
Login to display prices
SLC25A40-solute carrier family 25, member 40 Gene View larger

SLC25A40-solute carrier family 25, member 40 Gene

PTXBC027322

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A40-solute carrier family 25, member 40 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A40-solute carrier family 25, member 40 Gene

Proteogenix catalog: PTXBC027322
Ncbi symbol: SLC25A40
Product name: SLC25A40-solute carrier family 25, member 40 Gene
Size: 2ug
Accessions: BC027322
Gene id: 55972
Gene description: solute carrier family 25, member 40
Synonyms: MCFP; solute carrier family 25 member 40; mitochondrial carrier family protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatcctgagacaaggggacaagagattatcaaagtgacacctcttcaacaaatgcttgcctcatgtactggagctatactgacatcagtaatagtgacacccctggatgttgttaaaattagactccaagcccaaaacaacccactccccaaaggaaaatgttttgtatatagtaatggactcatggatcatctatgtgtctgtgaagagggaggcaacaaactatggtataagaagccaggaaatttccagggaacattggatgcattttttaaaatcattcgaaatgagggcattaaatctctatggagtggccttcctcctaccctagtgatggcagttcctgccacagttatttattttacctgctatgatcaattaagtgctcttctgagatctaagttaggagaaaatgaaacctgcataccaattgttgctggaattgtagccagatttggtgcagtaactgtgataagtccactagaattgattagaaccaagatgcagtccaagaagttttcttacgtggaactgcatcgatttgtcagcaagaaagtatctgaagatggttggatttccctttggaggggctgggctcctactgttcttagagatgtacctttctcagcaatgtactggtataactatgaaattttaaagaagtggttatgtgagaaatctggtttatatgagccaacatttatgatcaactttacttcaggggcattgtctggttcttttgctgctgttgcaactttaccatttgatgtagtaaaaacacaaaagcagacacaactttggacatatgaaagtcataaaatttctatgcctttgcatatgtcaacctggattataatgaagaacattgttgctaaaaatggattttccggattattttcaggcctaattcctcgcttaattaaaattgctcctgcttgtgccattatgatcagtacatatgaatttggaaaggcttttttccagaaacaaaatgttcgaaggcagcaatactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: