Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of GCET2-germinal center expressed transcript 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GCET2-germinal center expressed transcript 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC030506 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GCET2 |
| Origin species: | Human |
| Product name: | GCET2-germinal center expressed transcript 2 Gene |
| Size: | 2ug |
| Accessions: | BC030506 |
| Gene id: | 257144 |
| Gene description: | germinal center expressed transcript 2 |
| Synonyms: | GCET2; GCAT2; germinal center-associated signaling and motility protein; germinal center B-cell-expressed transcript 2 protein; germinal center expressed transcript 2; germinal center-associated lymphoma protein; human germinal center-associated lymphoma; germinal center associated signaling and motility |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggaaattctctgctgagagaaaacaggcggcagcagaacactcaagagatgccttggaatgtgagaatgcaaagccccaaacagagaacatccagatgctgggatcaccatatcgctgaagggtgtttctgccttccatggaaaaaaatactcatttttgaaaagaggcaagattcccaaaacgaaaatgaaagaatgtcatctactcccatccaggacaatgttgaccagacctactcagaggagctgtgctataccctcatcaatcatcgggttctctgtacaaggccatcagggaactctgctgaagagtactatgagaatgttccctgcaaagctgagagacccagagagtccttgggaggaactgagactgagtattcacttctacatatgccttctacagaccccaggcatgcccgatccccagaagatgaatatgaacttctcatgcctcacagaatctcctctcactttctgcaacagccacgtccacttatggccccttctgagactcagttttcccatttatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger protein 28 homolog (mouse) - chromosome 1 open reading frame 135 - src kinase associated phosphoprotein 2 - ATPase family, AAA domain containing 2 |