Login to display prices
Login to display prices
SKAP2-src kinase associated phosphoprotein 2 Gene View larger

SKAP2-src kinase associated phosphoprotein 2 Gene

PTXBC002893

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SKAP2-src kinase associated phosphoprotein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SKAP2-src kinase associated phosphoprotein 2 Gene

Proteogenix catalog: PTXBC002893
Ncbi symbol: SKAP2
Product name: SKAP2-src kinase associated phosphoprotein 2 Gene
Size: 2ug
Accessions: BC002893
Gene id: 8935
Gene description: src kinase associated phosphoprotein 2
Synonyms: PRAP; RA70; SAPS; SCAP2; SKAP-HOM; SKAP55R; src kinase-associated phosphoprotein 2; Fyn-associated phosphoprotein SKAP55 homologue; Pyk2/RAFTK-associated protein; SKAP-55HOM; SKAP55 homolog; retinoic acid-induced protein 70; src family-associated phosphoprotein 2; src kinase-associated phosphoprotein of 55-related protein; src-associated adapter protein with PH and SH3 domains; src kinase associated phosphoprotein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccaaccccagcagcacctcctctccctaccccctccctgaggaaattaggaacctgttggcagatgttgaaacatttgtagcagatatactgaaaggagaaaatttatccaagaaagcaaaggaaaagagagaatcccttattaagaagataaaagatgtaaagtctatctatcttcaggaatttcaagacaaaggtgatgcagaagatggggaagaatatgatgacccttttgctgggcctccagacactatttcattagcctcagaacgatatgataaagacgatgaagccccctctgatggagcccagtttcctccaattgcagcacaagaccttccttttgttctaaaggctggctaccttgaaaaacgcagaaaagatcacagctttctgggatttgaatggcagaaacggtggtgtgctctcagtaaaacggtattctattattatggaagtgataaagacaaacaacagaaaggtgaatttgcaatagatggctacagtgtcagaatgaataacactctaagaaaggatggaaagaaagattgctgttttgaaatctctgctcctgataaacgtatatatcagtttacagcagcttctcccaaagatgctgaagaatgggtacagcagctgaaatttgtattgcaagatatggaatctgatattattcctgaggattatgatgagagaggagaattatatgatgatgttgatcatcctctaccaataagcaatccactaacaagcagtcaaccaatagatgatgaaatttatgaagaacttccagaagaagaagaggacagtgctccagtgaaagtggaagaacaaaggaagatgagtcaggatagtgtccatcacacctcaggggataagagcactgattatgctaatttttaccagggattgtgggattgtactggagctttttctgatgagttgtcatttaagcgtggtgatgtgatttacattcttagcaaggaatacaatagatatggctggtgggtaggagaaatgaagggagccattggcttggtgcctaaagcctacataatggagatgtatgatatttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: