Login to display prices
Login to display prices
FGD6-FYVE, RhoGEF and PH domain containing 6 Gene View larger

FGD6-FYVE, RhoGEF and PH domain containing 6 Gene

PTXBC013319

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGD6-FYVE, RhoGEF and PH domain containing 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FGD6-FYVE, RhoGEF and PH domain containing 6 Gene

Proteogenix catalog: PTXBC013319
Ncbi symbol: FGD6
Product name: FGD6-FYVE, RhoGEF and PH domain containing 6 Gene
Size: 2ug
Accessions: BC013319
Gene id: 55785
Gene description: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24; FYVE, RhoGEF and PH domain-containing protein 6; zinc finger FYVE domain-containing protein 24; FYVE, RhoGEF and PH domain containing 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagccctcgctgtgctaatctggccctcaagcactacctgctcaagccggttcagaggatcccccagtacaggctgttgctgacagattatttgaagaatctcatagaagatgctggagattacagagacactcaagatgcccttgctgttgttgtagaggtagccaaccacgccaatgacaccatgaagcaaggagacaactttcagaaacttatgcaaattcagtacagcttaaatggacaccatgaaattgtgcagcctggtcgggtttttctcaaagaaggaattctgatgaagctgtctcggaaagtgatgcaacctcgaatgtttttcctgtttaatgatgccctgctgtatacaacaccagtgcagtctgggatgtataaactgaacaacatgctctcactggctggaatgaaggtcagaaaacctacccaagaagcctatcagaatgaattaaagattgaaagtgtagaacgttccttcattctctcagccagttctgccacagaaagggatgaatggctagaagcgatttccagggcaatagaagagtatgccaagaaaagaatcaccttctgtcctagtaggagtcttgatgaggcagactcagaaaataaagaagaagttagtcctcttggatcgaaggctcccatctggattcctgataccagagccacaatgtgtatgatctgcacaagcgaattcactctcacctggagacgacaccactgccgggcctgtggaaagattgtatgccaagcttgttcgtctaataagtatggcttagattacctgaaaaatcaaccagcaagagtatgtgaacattgtttccaagaactgcagaaattagatcaccagcactcccctaggattggatctcctggaaatcacaaatctccttcaagtgccttatcatcagtcttacatagcattccatcagggaggaaacagaaaaaaatcccagctgctctcaaagaagtatcagcaaacacagaggattcttctatgagtggctacttgtacagatcaaagggcaataaaaaaccctggaaacacttttggtttgtcataaaaaataaagtactatatacatatgctgcaagtgaggtaagatctgaaatctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: