C6orf199-chromosome 6 open reading frame 199 Gene View larger

C6orf199-chromosome 6 open reading frame 199 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf199-chromosome 6 open reading frame 199 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf199-chromosome 6 open reading frame 199 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022031
Product type: DNA & cDNA
Ncbi symbol: C6orf199
Origin species: Human
Product name: C6orf199-chromosome 6 open reading frame 199 Gene
Size: 2ug
Accessions: BC022031
Gene id: 221264
Gene description: chromosome 6 open reading frame 199
Synonyms: C6orf199; AK 9; AKD1; AKD2; C6orf224; dJ70A9.1; adenylate kinase 9; adenylate kinase domain containing 1; adenylate kinase domain containing 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacttctcaagagaagacagaagagtatccttttgcagatatatttgatgaagatgaaactgaaaggaattttttgttgtccaaacctgtttgctttgttgtatttgggaaaccaggtgttgggaaaacaacattagcccgttacataacacaggcatggaaatgtattcgtgttgaagctttgccaattttagaagaacagattgctgctgaaaccgaatcaggagttatgttgcaatcaatgttgatcagcggtcaaagcattccagatgaacttgtcataaagctaatgttggagaagctcaactccccagaagtctgtcactttggttatattatcactgaaataccatcactttcacaggatgccatgactaccttacagcaaatagaattaattaaaaacttaaacctgaaacctgatgttataatcaatataaagtgtcctgactatgatttgtgccagagaatttctgggcaaagacagcacaataatacgggatacatatacagtagagaccagtgggatcctgaagtcattgagaatcataggaaaaagaagaaagaagcccaaaaggacggaaaaggagaagaggaagaagaggaagaagagcaagaagaagaagaggcatttattgccgaaatgcagatggtggctgaaattcttcatcatctagtccagaggcctgaagattatttggaaaatgttgaaaacattgttaagctttataaggaaacaattctccaaactttagaagaagtaatggctgaacacaatccccagtatctcattgagctaaatggaaataaaccagcagaggagctctttatgattgttatggatcgacttaaatatctgaacctaaaaagagcagctattctaaccaaacttcagggtgcagaggaagaaattaatgacacaatggaaaatgatgagctatttcgtactcttgcatcttataaacttattgcaccaagatacagatggcaaagaagtaaatggggacgtacatgtcctgtgaatttaaaagatggtaacatttattcaggattaccagattattctgtgagttttctaggtaaaatctactgtctttcatcagaagaagcattaaaaccatttttgttgaacccacgtccctatctgcttccacctatgccaggaccaccatgtaaagtattcatacttggacctcaatattcagggaaaacaacactttgcaatatgcttgcagaaaattacaaaggaaaggtgactaactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - saccharopine dehydrogenase (putative)
- sialic acid binding Ig-like lectin 6
- zinc finger, MYND-type containing 10
- chromosome 11 open reading frame 24

Buy C6orf199-chromosome 6 open reading frame 199 Gene now

Add to cart