SIGLEC6-sialic acid binding Ig-like lectin 6 Gene View larger

SIGLEC6-sialic acid binding Ig-like lectin 6 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIGLEC6-sialic acid binding Ig-like lectin 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SIGLEC6-sialic acid binding Ig-like lectin 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035359
Product type: DNA & cDNA
Ncbi symbol: SIGLEC6
Origin species: Human
Product name: SIGLEC6-sialic acid binding Ig-like lectin 6 Gene
Size: 2ug
Accessions: BC035359
Gene id: 946
Gene description: sialic acid binding Ig-like lectin 6
Synonyms: CD327; CD33L; CD33L1; CD33L2; CDW327; OBBP1; sialic acid-binding Ig-like lectin 6; CD33 antigen-like 1; obesity-binding protein 1; sialic acid binding Ig like lectin 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagggagcccaggaagcctccgcctcagagatgctaccgctgctgctgcccctgctgtgggcaggggccctggctcaggagcggagattccagctggaggggccagagtcactgacggtgcaggagggtctgtgcgtcctcgtaccctgcagattgcccactacccttccagcctcgtactatggttatggctactggttcctggaaggggctgatgttccagtggccacaaacgacccagacgaagaagtgcaggaggagacccggggccgattccacctcctctgggatcccagaaggaagaactgctccctgagcatcagagatgcccggaggagggacaatgctgcatacttctttcggttgaagtccaaatggatgaaatacggttatacatcttccaagctctctgtgcgtgtgatggccctgacccacaggcccaacatctccatcccagggaccctggagtctggccatcccagcaatctgacctgctctgtgccctgggtctgtgagcaggggacgccccccatcttctcctggatgtcagctgcccccacctccctgggccccaggaccacccagtcctcggtgctcacaatcaccccacggccccaggaccacagcaccaacctcacctgtcaggtgacgttccctggagccggtgtgaccatggagagaaccatccagctcaatgtctcctccttcaaaatcctgcaaaacacctcgtccctccctgtcctggagggccaggctctgcggctgctctgtgatgctgacggcaacccccctgcacacctgagctggttccagggcttccccgccctgaacgccacccccatctccaataccggggtcctggagctgcctcaagtagggtctgcagaagaaggagatttcacctgccgtgctcagcatcctctgggctccctgcaaatctctctgagtctctttgtgcattggaaaccagaaggcagggctggtggtgtcctgggagcagtctggggagctagcatcacaaccctggttttcctctgtgtttgcttcatcttcagagtgaagactagaaggaagaaagcagcccagccagtgcaaaacacggatgatgtgaaccccgtcatggtctcaggctccaggggtcatcagcaccagttccagacaggcatagtttcagaccaccctgctgaggctggccccatctcagaagatgagcaggagctccactacgctgtcctacacttccacaaggtgcaacctcaggaaccaaaggtcaccgacactgagtactcagaaatcaagatacacaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger, MYND-type containing 10
- chromosome 11 open reading frame 24
- chromosome 6 open reading frame 182
- chromosome 16 open reading frame 58

Buy SIGLEC6-sialic acid binding Ig-like lectin 6 Gene now

Add to cart